Bilgi

RNA izolasyonu- pH'ın rolü

RNA izolasyonu- pH'ın rolü


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Düşük pH'da fenol-kloroform ile işlendiğinde neden RNA tek başına sulu faza giriyor? Nötr veya bazik bir pH'ta hem DNA hem de RNA sulu faza kaçar. Peki DNA asidik pH'ta nasıl tutulur?


Asit fenol ekstraksiyonunun amacı, DNA organik faza bölünürken veya interfazda birleşirken RNA'yı sulu fazda seçici olarak tutmaktır. İnternette birçok insanın bunun, RNA fosfatlarının iyonik kalmasına ve dolayısıyla farklı çözünürlükler vermesine karşın DNA fosfatlarının protonasyonundan kaynaklandığını söylediğini buldum. Bu açıklamayı satın almıyorum çünkü:

  • Fosfodiester parçasının pKa'sı, asit fenol ekstraksiyonlarında kullanılan pH'dan birkaç kat daha düşüktür ve bu nedenle büyük ölçüde protondan arındırılmalıdır.
  • Benzer yapıları göz önüne alındığında, RNA ve DNA arasındaki pKa'daki büyük fark, hazırlayıcı olarak yararlı olması için bana mantıksız görünüyor.
  • Bilimsel literatürde böyle bir iddiaya rastlamadım.

DNA ve RNA'nın akla gelen ve diferansiyel çözünürlüğü açıklayabilecek özellikleri şunlardır:

  • DNA, pozitif yük veren nükleobazların protonasyonu nedeniyle asitte denatüre olur. Bu abilir kümelenmesini kolaylaştırır.
  • DNA genellikle daha uzundur.
  • RNA, molekülün polaritesini artıran bir 2' hidroksil grubuna sahiptir.

Bunu biraz destekleyen ThermoFisher'dan bir SSS:

Fenolde nükleik asitlerin bölünmesi pH'a bağlıdır. pH 7.0 veya üzerinde, hem DNA hem de RNA sulu faza bölünür. Asidik bir pH'ta (7.0'ın altında) DNA denatüre olur ve organik faza geçer, ancak RNA sulu fazda kalır.

Kesin biyofizik benden kaçıyor. Bunun bir cevap değil, daha çok uzun bir yorum olduğunun farkındayım. Aklımda bir yanlış anlama olabileceğini ele almanın önemli olduğunu düşündüm. Eleştirilere açığız.


Bu durumda RNA'nın davranışını belirleyen iki özellik vardır:

  • Polaritesi;
  • Asitliği.

Polaritesi nedeniyle RNA, fenol-kloroform fazından kaçma eğilimindedir; aslında o Yapabilmek pH nötr olsa bile sulu faza geçer [1], ancak pH asidik olduğundan daha düşük bir verimle. İşte ikinci özellik, RNA asitliği geliyor. Bu nedenle, RNA nötr bir çözelti içindeyken negatif bir yüke sahiptir: fosfat grubunun $-OH$s'leri $-O^-$ ve $H^+$'a ayrışır. Ancak bu, zaten çok fazla $H^+$ bulunan asidik bir çözeltide gerçekleşmez. Bu nedenle, temel pH'da $-OH$ grupları sağlamdır ve nötr bir yüke sahiptir; bu sistemi stabilize eder.
Bir düşünün: eğer sulu faz nötr pH'daysa ve negatif yüklü RNA molekülleri ile dolarsa, bir süre sonra bu çözeltiye daha fazla negatif molekül giremez. Öte yandan, sulu faza giren RNA molekülleri elektrostatik olarak nötr kalırsa, çözeltiye giren moleküllerin sayısı yalnızca onları çözecek su moleküllerinin mevcudiyeti ile sınırlı olacaktır.

Bu nedenle asidik* pH kullanırsınız, bu sadece bir verimlilik meselesidir.

Feragatname: Bu cevap, OQ kapsamında OP tarafından yapılan bir yoruma dayanmaktadır.

[1] RNA'yı çıkarmak için asla yüksek pH'lı bir çözelti kullanmazsınız çünkü böyle bir durum RNA'yı hidrolize eder.


Asit guanidinyum tiyosiyanat-fenol-kloroform ekstraksiyonu

Asit guanidinyum tiyosiyanat-fenol-kloroform ekstraksiyonu (kısaltılmış AGPC) biyokimyada bir sıvı-sıvı ekstraksiyon tekniğidir. Moleküler biyolojide RNA'yı (bazı durumlarda DNA ve proteinin yanı sıra) izole etmek için yaygın olarak kullanılır. Bu yöntem, silika bazlı saflaştırma gibi kolon bazlı bir sistemden daha uzun sürebilir, ancak daha yüksek saflığa ve yüksek RNA geri kazanımı avantajına sahiptir: [1] bir RNA kolonu tipik olarak kısa (<200 nükleotit) RNA'nın saflaştırılması için uygun değildir. siRNA, miRNA, gRNA ve tRNA gibi türler.

İlk olarak 1987'de protokollerini yayınlayan Piotr Chomczynski ve Nicoletta Sacchi tarafından geliştirilmiştir. [2] [3] Reaktif Sigma-Aldrich tarafından TRI Reagent adıyla Invitrogen tarafından TRIzol adı altında Bioline tarafından Trisure olarak ve Tel tarafından satılmaktadır. -STAT-60 olarak test edin.


DNA, RNA ve protein ekstraksiyonu: geçmiş ve bugün

DNA, RNA ve proteinin ekstraksiyonu moleküler biyolojide kullanılan temel yöntemdir. Bu biyomoleküller, sonraki akış aşağı prosesler, analitik veya hazırlayıcı amaçlar için herhangi bir biyolojik materyalden izole edilebilir. Geçmişte, nükleik asitlerin ekstraksiyonu ve saflaştırılması işlemi, karmaşık, zaman alıcı, emek yoğun ve genel verim açısından sınırlıydı. Şu anda, çözüm tabanlı ve sütun tabanlı protokoller gibi saf biyomolekülleri çıkarmak için kullanılabilecek birçok özel yöntem vardır. Manuel yöntem, nükleik asidi izole etmek için gereken bileşenlerin çoğunu içeren eksiksiz kitleri içeren çeşitli ticari tekliflerle zaman içinde kesinlikle uzun bir yol kat etti, ancak çoğu, numunenin türüne ve ek mekanik işlem. Orta ila büyük ölçekli laboratuvarlar için tasarlanan otomatik sistemlere olan talep son yıllarda arttı. Emek yoğun manuel yöntemlere bir alternatiftir. Teknoloji, yüksek bir numune verimine izin vermeli, biyomoleküllerin verimi, saflığı, tekrarlanabilirliği ve ölçeklenebilirliğinin yanı sıra testin hızı, doğruluğu ve güvenilirliği maksimum olmalı ve çapraz kontaminasyon riskini en aza indirmelidir.


RNA'nın TRIzol (TRI reaktifi) kullanılarak saflaştırılması

TRIzol çözündürme ve özütleme, RNA'yı proteinden arındırmak için nispeten yakın zamanda geliştirilmiş genel bir yöntemdir. Bu yöntem, hücrelerin veya dokuların endojen RNazlar için zenginleştirildiği veya sitoplazmik RNA'nın nükleer RNA'dan ayrılmasının pratik olmadığı durumlarda özellikle avantajlıdır. TRIzol (veya TRI Reaktifi), aynı anda biyolojik materyali çözündüren ve proteini denatüre eden fenol ve guanidinyum izotiyosiyanatın monofazik bir çözeltisidir. Çözündürmeden sonra, kloroform ilavesi faz ayrılmasına neden olur (fenol:kloroform:izoamil alkol ile ekstraksiyon gibi), burada protein organik faza ekstrakte edilir, DNA arayüzde çözülür ve RNA sulu fazda kalır. Bu nedenle, RNA, DNA ve protein tek bir numuneden (dolayısıyla TRIzol adı) saflaştırılabilir. TRIzol ekstraksiyonu ayrıca mikroRNA'lar, piwi ile ilişkili RNA'lar veya endojen, küçük enterferans yapan RNA'lar gibi küçük RNA'ları izole etmek için etkili bir yöntemdir. Bununla birlikte, TRIzol pahalıdır ve RNA peletlerinin yeniden süspanse edilmesi zor olabilir. Bu nedenle, düzenli fenol ekstraksiyonu pratik olduğunda TRIzol kullanımı önerilmez.


Nükleik asit ekstraksiyon yöntemleri

Nükleik ekstraksiyon yöntemleri yaygın olarak iki farklı tipte tanımlanabilir:

Çözüme dayalı yöntemler

Nükleik asit ekstraksiyonu için ilk yöntemlerin çoğu, donmuş biyolojik örneklerin öğütülmesine ve ardından RNA ve/veya DNA'nın saflaştırılmasını mümkün kılmak için tasarlanmış kimyasal çözeltilerle karıştırılmasına dayanıyordu.

1. Sezyum Klorür Gradyan Santrifüjü (Etidyum Bromür ile)

Bu yöntem, kaldırma ve özgül yoğunluk fenomenlerine dayanmaktadır. Sezyum klorür (CsCl) son derece yoğun bir tuzdur. Bu tuzun çözeltileri çok yüksek hızlarda (tipik olarak >100.000 rpm) santrifüjlemeye tabi tutulduğunda, CsCl bir konsantrasyon gradyanı oluşturur, burada santrifüj tüpünün bir ucunda veya yanında yüksek oranda konsantre olur. ve diğerinde çok daha az konsantre. Santrifüj işlemi, santrifüj yavaş yavaş yavaşlarken yavaşça sona erdirilirse, daha yoğun çözelti (daha yüksek CsCl konsantrasyonuna sahip) bir süre konsantrasyon gradyanını koruyarak tüpün dibine çökecektir. Çözeltide çözünen diğer moleküller, ne kadar yoğun olduklarına göre, daha yoğun moleküller tüpün dibine doğru giderken ve daha az yoğun moleküller yukarı doğru hareket ederek kendilerini ayıracaktır. DNA, etidyum bromür adı verilen bir molekülün varlığında ona bağlanacak ve UV ışığı altında floresan hale gelecektir. Etidyum bromür ayrıca DNA'nın yoğunluğunu, santrifüjleme sonrasında tüpün merkezine doğru hareket edecek şekilde ayarlar. Kirleticiler farklı pozisyonlara hareket edecek ve bu nedenle floresan olacağı için kolayca görülebilen ve geri kazanılabilen DNA'dan ayrılacaktır. Sonraki adımlar DNA'yı CsCl ve etidyum bromürden ayıracaktır. Bu teknik, bakterilerin antibiyotik direnci hakkında birbirleriyle bilgi paylaşmak için kullandıkları küçük DNA zincirleri olan plazmitleri ve mitokondriyal DNA'yı ve etidyum bromürün karakteristik miktarlarına bağlanan diğer spesifik DNA moleküllerini ayırmak için özellikle etkilidir. benzersiz yoğunluklara sahiptir. Mitokondriyal ve plazmit DNA'yı ayırmak kolaydır. Bu nükleik asitler, yüksek derecede sarmal (süper sarmal olarak adlandırılır) dairesel modellerde düzenlenir. Süper sarmal olmayan DNA (çok daha uzun kromozomal DNA türleri gibi) farklı miktarlarda etidyum bromide bağlanır ve farklı bir yoğunluğa sahiptir, bu da onların plazmit DNA'dan ayrılmasını kolaylaştırır.

2. Guanidinium Tiyosiyanat-Fenol-Kloroform nükleik asit ekstraksiyonu

Solventler fenol ve kloroform ile karıştırıldığında, tuz guanidinyum tiyosiyanatın sulu bir çözeltisi, minimum sayıda adım yoluyla RNA'nın etkili bir şekilde saflaştırılmasına izin verir. Numuneler öğütüldüğünde ve kloroform, fenol, sodyum asetat ve guanidinyum tiyosiyanat ile karıştırıldığında ve santrifüjlemeye tabi tutulduğunda, tuz çözeltisi çözücülerden ayrılacak ve bir üst sulu faz ve çözücülerden oluşan bir alt organik faz sağlayacaktır. Proteinler, diğer nükleik asitler ve diğer kirleticiler organik faza veya iki faz arasındaki arayüze hareket ederken RNA sulu fazda kalacaktır.

3. Setiltrimetilamonyum Bromür nükleik asit ekstraksiyonu

Bu teknik daha çok bitki örnekleri ile bunların tane, tohum ve yaprak gibi kısımları için kullanılmaktadır. Ayrıca birçok gıda numunesi için kullanılır. Nükleik asitler ve diğer bazı polisakaritler, yüksek pH'da %2 Setiltrimetilamonyum Bromür nükleik asit ekstraksiyonu (CTAB) çözeltilerinde çözünmezler. Nötr polisakkaritler ve proteinler çözünür. Bu, daha fazla saflaştırmadan önce birçok zor bitki bazlı kirleticiyi çıkarmak için kolay bir yol sağlar.

4. Chelex® Ekstraksiyonu

Bu teknik, adli tıp alanında yanak swabları, kan lekesi kartları ve saç gibi farklı kaynaklardan DNA ekstraksiyonu için kullanılmaktadır. Bu yöntem bir reçine kullanır (ticari Chelex®, polimeraz zincir reaksiyonu (PCR) işleminin ortak inhibitörlerine bağlanan. Bu, oldukça ham bir numune verir, ancak DNA'yı koruyan ve PCR tabanlı adli analiz için faydalı kılan bir numune.

5. Alkali Ekstraksiyon

Bu teknik, plazmit DNA izolasyonu için, kendi başına nispeten ham preparasyonlar için veya hemen hemen tüm plazmit saflaştırma işlemlerinde ilk adım olarak kullanılır. Bir kültür ortamından ilgilenilen bakterilerin hasat edilmesini ve sonuç olarak bakterilerin yüksek oranda alkali bir çözeltiye maruz bırakılmasını içerir. Bunu genellikle alkali özütün, proteinleri ve diğer kirleticilerin çoğunu ortadan kaldıran deterjan Sodyum Dodesil Sülfat ile karıştırılması izler. Bu yöntemlerin en büyük avantajlarından biri, büyük kromozomal DNA'ya bağlı birçok protein bulunduğundan, proteinlerle birlikte bu DNA'nın da ortadan kaldırılmasıdır. Moleküler klonlama teknikleri, plazmid DNA'nın manipüle edilmesine bağlı olduğundan, kromozomal DNA'nın çıkarılması kritiktir.

Katı fazlı nükleik asit ekstraksiyonu

Katı faz ekstraksiyon yöntemleri, nükleik asitlerin silika veya diğer malzemelerle kaplanmış manyetik boncuklar gibi katı desteklere bağlanmasına neden olarak çalışır. Boncuklar (veya diğer destekler) daha sonra kirleticileri çıkarmak için alkol ile yıkanır. Destek daha sonra nükleik asitleri tekrar çözünür hale getiren ve elüsyon olarak bilinen bir işlemde DNA'yı destekten kurtaran bir sıvı ile yıkanır. Basit bir yöntem, ham nükleik asit ekstraktına bir kaotrop içeren bir çözelti eklemektir. Kaotropik ajanlar, su molekülleri arasındaki hidrojen bağ ağını bozan moleküllerdir. Kaotropların varlığında, nükleik asitler önceleri çok daha az çözünür ve cama, silika kaplı manyetik boncuklara ve diğer katı desteklere bağlanacak ve bu da onları kirleticilerden ayırmayı kolaylaştıracaktır. Katı faz ekstraksiyon yöntemleri ayrıca DNA ve RNA'nın iyon değişim reçinelerine veya diğer kimyalara seçici olarak bağlanmasına da bağlı olabilir.


Yöntemler

Hücre kültürü

MDCK-London hücreleri 14, %10 fetal sığır serumu (Hyclone) ve 2 mM glutamin ile desteklenmiş DMEM (Mediatech, Inc.) kullanılarak çoğaltılmıştır. İnfluenza virüsü (A/Brisbane/59/2007) ile enfeksiyon, glutamin (2 mM), HEPES (25 mM), sığır serum albümini (%0.2 A7888 Sigma) ve TPCK-tripsin ile desteklenmiş DMEM'den oluşan bir enfeksiyon ortamında gerçekleştirildi ( 1 ug/mL T1426 Sigma). 24 oyuklu bir hücre kültürü plakası formatı kullanan deneyler için, tripsinize edilmiş hücrelerin bir süspansiyonu (serum 300.000 hücre/kuyuyu çıkarmak için iyice yıkandı) virüs (10.000 TCID) ile karıştırıldı.50/kuyu) enfeksiyon ortamında (1 mL/kuyu). Hücrelerin yapışmasına izin verildi ve enfeksiyondan 6 saat sonra hücre lizatları hazırlandı.

RT-qPCR-hazır hücre lizatlarının hazırlanması

24 oyuklu plakalardaki MDCK-London hücreleri bir kez PBS (1 mL/çukur) ile yıkandı. Hücre lizatları, hücre tek tabakalarının 200 uL/yuva Bio-Rad iScript Numune Hazırlama Reaktifine (Bio-Rad SPR 170-8898 olarak anılır) veya Hücre Lizis (CL) Tamponuna maruz bırakılmasıyla hazırlandı. CL Tamponunun nihai formülasyonu, 10 mM Tris-HCl pH 7.4, %0.25 Igepal CA-630 ve 150 mM NaCl'den oluşuyordu. CL Tamponu, deney gününde aşağıdaki stok çözeltilerden taze olarak hazırlandı: 1 M Tris-HCl (T2194 Sigma), %10 Igepal CA-630 (I8896 Sigma) ve 5 M NaCl (351-036-100 Quality Biological, Inc. .). Tüm reaktifler moleküler biyoloji sınıfındaydı ve seyreltmeler DEPC ile işlenmiş su (351-068-721 Quality Biological, Inc.) ile yapıldı. Belirli deneyler için, CL Tamponu ayrıca MgCl içerir2 (M1028 Sigma) veya RNasin Plus RNase İnhibitörü (N2615 Promega). Hem Bio-Rad SPR hem de CL Buffer, kullanımdan önce oda sıcaklığına dengelendi. Hücreler belirtilen süreler boyunca maruz bırakıldı (tipik olarak Bio-Rad SPR için 2 dakika ve CL Tamponu için 5 dakika). Elde edilen lizatlar, hücre-tek tabaka kalıntılarını bozmadan dikkatli bir şekilde toplandı ve ya hemen analiz edildi ya da dondurularak (-20°C veya -80°C) saklandı.

İnfluenza virüsü matris gen ekspresyonunun RT-qPCR analizi

Deneyler, MIQE yönergelerine 15 uyumlu olacak şekilde tasarlanmıştır. RT-qPCR analizi, daha önceki bir çalışmada 1 tarif edildiği gibi yapıldı. İnfluenza A virüslerinin matris geninin yüksek oranda korunmuş 104 bp bölgesini çoğaltan PCR primerleri (ileri: AAGACCATCCTGTCACCTCTGA ters: CAAAGCGTCTACGCTGCAGTCC), tek adımlı SYBR Green RT-qPCR'de kullanıldı. Her reaksiyon şunları içeriyordu: şablon (1 μL hücre lizatı), 1 × iScript One-Step SYBR Green RT-PCR Supermix (170–8893 Bio-Rad), her primerden 600 nM (Facility for Biotechnology Resources CBER, FDA'da sentezlendi Bethesda, MD) ve 10 μL'ye kadar nükleaz içermeyen su. Aşağıdaki protokolle bir CFX96 gerçek zamanlı PCR cihazı (Bio-Rad) kullanıldı: 50°C 10 dakika (1×), 95°C 5 dakika (1×), 95°C 10 saniye/61° 15 saniye C/72°C 30 saniye (40×) veri toplama 72°C uzatma adımından sonra gerçekleşti. İnfluenza virüsü suşu A/PR/8/34 ile enfekte olmuş MDCK-Londra hücrelerinden saflaştırılan toplam RNA, daha önce 1 tarif edildiği gibi bir RT-qPCR miktar belirleme standardı olarak kullanıldı. Her RT-qPCR çalışması için, RT-qPCR performansını doğrulamak ve kantifikasyonu kolaylaştırmak için standardın 10 kat seyreltme serisi (seyreltici olarak enfekte olmamış hücrelerden hazırlanan hücre lizatı kullanılarak) en az iki kopya halinde değerlendirildi. Ek olarak, her RT-qPCR çalışması, negatif kontroller (giriş olarak enfekte olmayan lizat) ve ters transkripsiyonsuz kontroller (yukarıda girdi olarak açıklanan RNA standardının ilk dilüsyonu) içeriyordu, bu kontroller tipik olarak hiçbir amplifikasyon veya düşük seviyeli spesifik olmayan amplifikasyonlarla sonuçlanıyor. (erime eğrisi analizi ile önerilen) C ileQ's > 36. İnfluenza virüsünün yaşam döngüsünde hiçbir DNA ara ürünü bulunmadığına dikkat etmek önemlidir.

RNA'nın mikroakışkan tabanlı değerlendirmesi

Hücre lizatlarından elde edilen toplam RNA, kit ile birlikte verilen "temizleme" protokolüne göre RNeasy Mini kiti (Qiagen) kullanılarak saflaştırıldı. ile başlayan

200 μL hücre lizatı, 700 μL Buffer RLT ve 500 μL etanol ilave edildi, karışım bir RNeasy Mini döndürme kolonundan geçirildi. Öngörülen yıkama adımlarının ardından, saflaştırılmış RNA, 30 μL nükleaz içermeyen su içinde ayrıştırıldı ve değerlendirmeye kadar -80°C'de saklandı. Saflaştırılmış RNA örnekleri (1 μL), sistem üreticisinin protokolüne göre mikroakışkan bazlı Experion RNA StdSens elektroforez analizine (Bio-Rad) tabi tutuldu. Experion tarafından ölçüldüğü gibi numune RNA konsantrasyonları tipik olarak 100–300 ng/μL aralığındadır (StdSens çipi için önerilen 5–500 ng/μL konsantrasyon aralığında).

İnfluenza virüsü için RT-qPCR tabanlı mikronötralizasyon testi

İnfluenza virüsü mikronötralizasyonu, daha önce tarif edildiği gibi yapıldı 1 . Grip aşısı geçmişi olan bir kişiden bir insan serumu 17 numunesi W. Wang ve C. Weiss'ten (Division of Viral Products, CBER, FDA) alındı. Serum örneği, ABD Gıda ve İlaç İdaresi'ndeki İnsan Denekleri Araştırma Komitesi (RIHSC) tarafından etik onayın ardından yazılı bilgilendirilmiş onam ile alındı. Serum numunesi, kullanımdan önce 56°C'de 30 dakika inkübasyon yoluyla ısıyla inaktive edildi. Enfeksiyon ortamı kullanılarak nötralizasyon deneyleri yapıldı. Virüs aşısı (1000 TCID50/50 uL), 96 oyuklu bir kültür plakasının bir oyuğunda bir serum seyreltisi (50 uL) ile karıştırıldı. 37°C'de 1 saat inkübasyonun ardından, MDCK-London hücrelerinin bir süspansiyonu (30.000 hücre/100 uL) ilave edildi. Enfeksiyondan 6 saat sonra, hücreler bir kez PBS ile yıkanarak ve oda sıcaklığında dengelenmiş 100 uL Bio-Rad SPR veya CL Tamponu eklenerek hücre lizatları hazırlandı, hücreler 2 dakika (Bio-Rad SPR) veya 5 dakika (CL Tamponu). Lizatlar toplandı ve değerlendirmeye kadar -20°C'de (Bio-Rad SPR numuneleri) veya -80°C'de (CL Tampon numuneleri) dondurularak saklandı. Matriks gen ekspresyonu ile yansıtıldığı gibi virüs replikasyonu, lizatların (1 μL) RT-qPCR ile analize tabi tutulmasıyla ölçülmüştür. Her deney numunesindeki RNA miktarı, hücrelerin nötralize edici serum yokluğunda enfekte olduğu kontrol kuyularından (virüs kontrol kuyuları) elde edilen ortalama değere (n ≥ 3) karşı normalleştirildi. Nötralizasyon titresi, RT-qPCR sinyalinin en az %90 inhibisyonu ile sonuçlanan en yüksek serum seyreltmesinin (virüs veya hücrelerin eklenmesinden önce) karşılığı olarak belirlendi.


Nükleik Asit Numune Kalite Değerlendirmesi

Numune işleme ve nükleik asit ekstraksiyon prosedürleri değişkendir, bu nedenle numune kalitesi ve miktarının analizi için güvenilir bir protokol tanımlamak ve bu analizin ayrıntılarını yayınlara 2 dahil etmek kritik öneme sahiptir. RNA miktarı büyük ölçüde rRNA verimi ile belirlenirken, RNA kalitesi saflığı (inhibitörlerin yokluğu) ve RNA moleküllerinin bütünlüğü ile belirlenir. Bununla birlikte, bir numunenin kalitesini ölçerken, saflık ve bütünlük sonuçları etkiler, düşük konsantrasyonlu bir numunenin saflığını ve bütünlüğünü belirlemek zordur ve safsızlıkların varlığı miktar tayinini etkileyebilir. Nükleik asit miktarını ve kalitesini değerlendirmek için kullanılabilecek birkaç teknik vardır, ancak bunların hiçbiri tek başına bir numuneyi tam olarak tanımlamak için gereken tüm bilgileri sağlamaz. Bu nedenle, numune kalitesinin nihai analiz verilerini 1 etkilemeyeceğinden emin olmak için bir dizi seçeneği dikkate almak önemlidir.

Nükleik Asit Sayımı

UV Spektroskopisi

Nükleik asitler geleneksel olarak bir spektrofotometre kullanılarak UV absorpsiyonunun ölçülmesiyle ölçülmüştür. Seyreltilmiş bir DNA veya RNA numunesinin absorbansı 260 nm ve 280 nm'de okunur. 260 nm'deki Optik Yoğunluk (OD), absorbans ve konsantrasyon arasında doğrusal bir korelasyon öngören Beer-Lambert yasasını kullanarak bir çözeltideki RNA veya DNA konsantrasyonunu belirlemek için kullanılır.

Bira-Lambert Yasası

A = ebc
A = absorbans
b = cm cinsinden küvetin yol uzunluğu (tipik olarak 1 cm)
c = analit konsantrasyonu
ε = sönme katsayısı

RNA için, ε = 40 μg/mL
DNA için, ε = 50 μg/mL

260 nm'de bir OD (A260) 1.0 okuması, yaklaşık 40 μg/mL saf RNA ve 50 μg/mL saf çift sarmallı DNA'ya eşdeğerdir. Ancak, Beer-Lambert yasası sadece 2'ye kadar olan OD okumaları için geçerlidir ve belirtilen OD/konsantrasyon ilişkisi numunelerin saf olmasına dayanır. Açıkça, 260 nm veya 280 nm'de absorpsiyonlu kirletici maddeler, tahmini OD okumasını etkileyecektir. Saf RNA'da A vardır260/A280 2.1, saf DNA ise A'ya sahip olacaktır.260/A280 1.8.

Proteinler, kaotrofik tuzlar ve fenol gibi potansiyel olarak kirletici maddelerin OD'si, örneğin absorbansı 280 nm ve 230 nm'de (A) ölçülürse de belirlenebilir.280 ve bir230, sırasıyla). Bu şekilde, A oranı260/A280 ve bir260/A230 numune saflığının bir göstergesi olarak kullanılabilir. Ancak, bu yaklaşımı 4 kullanırken DNA'daki protein kontaminasyonunun belirlenmesinin çok duyarsız olduğu belirtilmelidir.

Ek olarak, tamponun pH ve iyonik gücü de OD okumasını bozar. A'da önemli bir değişkenlik olduğu gösterilmiştir.260/A280 spektrofotometrik tayinleri gerçekleştirmek için farklı su kaynakları kullanıldığında oran. Örneğin, RNA'yı askıya almak için kullanılan pH 5,4 ila 7,5–8,5 arasındaki suyun pH'ındaki değişiklik, RNA A'yı önemli ölçüde artırdı.260/A280 oranlar yaklaşık 1,5 ila 2,0 5 .

Önemli olan, hem A260/A280 oran ve A260/A230 oranlar 2.0'a yakındır (Tablo 7.1).

TRIS, Etanol ve İzopropanol Kontaminasyonu

TRIS kontaminasyonunun etkisi: TRIS kontaminasyonu, RNA/DNA'nın absorbans spektrumunu önemli ölçüde etkilemez.

Etanol kontaminasyonunun etkisi: Etanol, TE pH 8.0'da ölçüldüğünde RNA/DNA'nın absorbans spektrumu üzerinde önemli bir etkiye sahip değildir. Ancak, ölçüm saf suda yapıldığında, A260/A280 oran azaltılabilir ve bu nedenle 2.0'dan düşük bir oran etanol kontaminasyonunu gösterebilir.

İzopropanol kontaminasyonunun etkisi: İzopropanol, TE pH 8.0'da ölçüldüğünde RNA/DNA'nın absorbans spektrumu üzerinde önemli bir etkiye sahip değildir. Ancak, ölçüm saf suda yapıldığında, A260/A280 oran azaltılabilir ve bu nedenle 2.0'dan düşük bir oran izopropanol kontaminasyonunu gösterebilir.

Protein, Guanidin İzotiyosiyanat ve Fenol Kontaminasyonu

Protein kontaminasyonunun etkisi: %0.01 BSA kontaminasyonu içeren bir numune, A kontaminasyonuna rağmen neredeyse normal bir absorbans spektrumu gösterebilir.260/A280 oran 1,9'un (RNA) veya 1,7'nin (DNA) altına düşebilir, bu da numuneyi kontamine eden bir şey olduğuna dair bir uyarıdır. %0.5 BSA'da, absorbans spektrumları anormal görünür ve bu, numunede önemli düzeyde kontaminasyon olduğunun açık bir göstergesidir. Bu nedenle, anormal A ile yüksek protein konsantrasyonları tespit edilebilir.260/A280 oranlar ama düşük ve orta miktarlar değildir.

Guanidin izotiyosiyanat kontaminasyonunun etkisi: Guanidin izotiyosiyanatın A üzerinde çok az etkisi vardır.260/A280 oranı, bu nedenle, guanidin izotiyosiyanatın RNA'nın nicelenmesi üzerinde küçük bir etkisi vardır. Bununla birlikte, guanidin izotiyosiyanatın varlığının A üzerinde çok güçlü bir etkisi vardır.260/A230 % 0,5 kontaminasyon oranı, A260/A230 oranı 0,5'in altına düşer. Guanidin kontaminasyonundan şüphelenilen numunelerden kaçınılmalıdır çünkü bu, aşağı yöndeki enzimatik reaksiyonlar üzerinde zararlı bir etkiye sahip olacaktır.

Fenol kontaminasyonunun etkisi: Fenol, RNA'nın miktar tayini üzerinde çok güçlü bir etkiye sahiptir. 50 ng/μL'de bir RNA numunesinin %0,5 fenol kontaminasyonunda, ölçülen konsantrasyon üç kattan fazladır. Fenolün RNA miktar tayini üzerindeki bu güçlü rahatsız edici etkisi, 270 nm'de kirletici absorpsiyon zirvesinden kaynaklanmaktadır. 10 ng/μL'nin altındaki çok düşük RNA konsantrasyonlarında, bu kirletici pik genellikle RNA ile karıştırılır. Bununla birlikte, RNA absorbansı her zaman 260 nm'dedir ve asla 270 nm'de değildir, bu nedenle pik 270 nm'de ise, bu bir kontaminasyondan kaynaklanmaktadır. RNA, fenole dayalı bir yöntem kullanılarak izole edildikten sonra, RNA konsantrasyonunun hatalı olarak fazla tahmin edilmesi ciddi bir problemdir. Bu, özellikle RNA düşük konsantrasyonda olduğunda geçerlidir.

Otomatik UV Spektrofotometrisi

Geleneksel UV spektroforezi, ölçümlerin nispeten yüksek hacimli numuneler kullanılarak yapılmasını gerektirse de, artık NanoDrop ® 2000 UV-Vis Spektrofotometre gibi otomatikleştirilmiş ve son derece küçük numune boyutlarının son derece hassas analizlerini destekleyen sistemler bulunmaktadır. Numune tutma sistemleri, küvet ve kapiler ihtiyacını ortadan kaldırarak analiz edilen numune miktarını 0,5 μL ile 2 μL arasına düşürür. NanoDrop, RNA/DNA konsantrasyonunu ve saflığını belirlemek için ilgili bölge olan yaklaşık 200 nm ila 350 nm arasındaki absorbansın bir taramasını sağlar.

Floresan bazlı Nükleik Asit Sayım Sistemleri

Nükleik asitleri ölçmek için floresan boyaların kullanımı, absorbans spektrofotometrisi 6,7'ye bir alternatiftir. Floresan yöntemleri kullanılarak nükleik asit konsantrasyonunun belirlenmesi, küçük moleküllerin veya boyaların nükleik asitlere bağlanmasını kullanır ve floresan özelliklerinde müteakip değişiklikleri ölçer. Absorbans spektrofotometrisinden daha pahalı olmasına rağmen, floresan bazlı kantifikasyon daha hassas, kesindir ve ilgilenilen nükleik asit için spesifik olabilir.

Florometreler floresansı mutlak birimlerden ziyade göreceli olarak ölçtüğünden, ölçüm ilk önce ölçülecek numuneye benzer özelliklere sahip bilinen bir standart nükleik asit çözeltisi konsantrasyonuyla kalibre edilir. Kalibrasyonun ardından, tek bir ölçüm solüsyondaki nükleik asit konsantrasyonunu belirleyebilir, ancak ölçülen aralıkta testin doğrusallığını tespit etmek için tipik olarak standart bir eğri gerekli olacaktır.

QuBit ® 2.0 florometre (Life Technologies) gibi otomatik sistemler, çözeltideki nükleik asit konsantrasyonunun ölçümü için bir dizi farklı floresan bazlı kantifikasyon tahlili ile kullanılabilir. Testler, algılama için geniş bir dinamik aralık gösterir ve küçük numuneleri doğru bir şekilde analiz etme yeteneğine sahiptir.

OD okumasının bir absorpsiyon ölçüsü olduğunu ve numune kalitesinin tam bir değerlendirmesi olarak kullanılamayacağını gözlemlemek çok önemlidir. Benzer şekilde, floresan tabanlı sistemler kalite değil nicelik ölçüsü sağlar. Örneğin, bunlar numune bütünlüğü için bir test olarak kullanılamaz ve kapiler elektroforez, jel çözünürlüğü veya 3'/5' oran testi (aşağıda açıklandığı gibi) gibi uygun bir analiz de gerçekleştirilmelidir.


Yöntemin aşamaları lize, bağlama, yıkama ve ayrıştırmadır. [1] [2] Daha spesifik olarak, bu, nükleik asitleri serbest bırakmak için hedef hücrelerin parçalanmasını, nükleik asidin bir silika membrana seçici olarak bağlanmasını, silika membrana bağlı olmayan partiküllerin ve inhibitörlerin yıkanmasını ve nükleik asitlerin ayrıştırılmasını gerektirir. asit, sonuç sulu bir çözelti içinde saflaştırılmış nükleik asittir.

Parçalama için numunenin hücreleri (kan, doku vb.) hücre zarını kırmak ve nükleik asidi serbest bırakmak için bir işleme tabi tutulmalıdır. Hedef malzemeye bağlı olarak, bu, deterjan veya diğer tamponların, proteinazların veya diğer enzimlerin kullanımını, çeşitli sürelere/sıcaklıklara kadar ısıtmayı veya bir bıçak veya homojenleştirici ile kesme, bir harç ve havan tokmağı veya boncuk kullanma gibi mekanik parçalamayı içerebilir. boncuk değirmeni ile dövülür.

Bağlama için, daha sonra parçalanmış numuneye etanol veya izopropanol ile birlikte bir tampon solüsyonu ilave edilir. Bağlama çözeltisindeki numune daha sonra bir döndürme kolonuna aktarılır ve kolon ya bir santrifüje konur ya da bir vakuma bağlanır. Santrifüj/vakum, çözeltiyi, doğru iyonik koşullar altında, çözeltinin geri kalanı geçerken nükleik asitlerin silika membrana bağlanacağı döndürme kolonunun içindeki bir silika membrandan geçmeye zorlar. Hedef malzeme bağlıyken, akış kaldırılabilir.

Yıkamak için kolona yeni bir tampon eklenir, ardından membrandan santrifüjlenir/vakumlanır. Bu tampon, bağlayıcı tuzları ve kalan diğer kirleticileri çıkarırken, bağlanma koşullarını korumayı amaçlar. Genellikle, silika membran üzerindeki nükleik asit kirleticilerden arındırılana kadar, genellikle artan yüzdelerde etanol/izopropanol ile birkaç yıkama alır. Son 'yıkama' genellikle alkolün buharlaşmasına izin vermek için kuru bir adımdır ve yalnızca kolona bağlı saflaştırılmış nükleik asitleri bırakır.

Son olarak, elüsyon, hidrofilik nükleik asidin kolondan ayrılmasına ve solüsyona geri dönmesine izin vererek kolona sulu bir solüsyon ekleme işlemidir. Bu adım tuz, pH, zaman veya ısı ile geliştirilebilir. Son olarak, elüat/elüenti yakalamak için kolon, son santrifüjleme adımından önce temiz bir mikrotüp içine aktarılır.

Günümüzde kullanılan nükleik asit yöntemlerinden bile önce, sodyum iyodür veya sodyum perklorat gibi kaotropik ajanların varlığında, DNA'nın silika, cam parçacıkları veya hücre duvarlarını silika ile koruyan diatom adı verilen tek hücreli alglere bağlandığı biliniyordu. Bu özellik, alkali koşullar altında cam tozu veya silika boncuklar kullanılarak nükleik asidi saflaştırmak için kullanıldı. [3] Bu daha sonra kaotropik ajan olarak guanidinyum tiyosiyanat veya guanidinyum hidroklorür kullanılarak geliştirildi. [4] Kullanım kolaylığı için, cam boncukların kullanımı daha sonra silika kolonlarla değiştirildi. Otomatik ekstraksiyon aletlerinin kullanımını sağlamak için, daha yaygın olarak "manyetik boncuk" ekstraksiyonu olarak adlandırılan silika kaplı paramanyetik boncuklar geliştirildi.


DNA en çok su fazında çözünür

Peki bunun DNA ve proteinin ayrılmasıyla ne ilgisi var?

Genel olarak, polar (yüklü) bileşikler en iyi polar çözücülerde çözünür ve polar olmayan moleküller daha az polar veya polar olmayan çözücülerde en iyi çözünür.

DNA, fosfat omurgasındaki negatif yükler nedeniyle polar bir moleküldür, bu nedenle suda çok çözünür, fenolde daha az çözünür. Bu, protokolde su(+DNA +protein) ve fenol karıştırıldığında, DNA'nın fenolde çözünmediği, ancak su fazında kaldığı anlamına gelir.


İyi Bir Tampon Yapan Nedir?

1966'da Norman Good ve meslektaşları biyokimyasal sistemler için en iyi tamponları tanımlamaya başladılar (Good ve diğerleri. 1966). İyi, bu tür arabellekler için birkaç kriter ortaya koydu:

  • bir pKa 6 ile 8 arasında. Çoğu biyokimyasal deney, 6&ndash8 aralığında optimal bir pH'a sahiptir. Bir tampon için optimal tamponlama aralığı, tamponun zayıf asit bileşeninin ayrışma sabitidir (pKa) artı veya eksi pH birimi.
  • Sudaki çözünürlük. Biyolojik reaksiyonlar çoğunlukla sulu ortamlarda meydana gelir ve bu nedenle tampon suda çözünür olmalıdır.
  • Biyolojik membranlar tarafından dışlama. Bu, tüm biyokimyasal reaksiyonlar için önemli değildir. However, if this is an important criterion for your particular experiment, it is helpful to remember that zwitterionic buffers (positive and negative charges on different atoms within the molecule) do not pass through biological membranes. Examples of zwitterionic buffers include MOPS and HEPES Tris and phosphate buffers do not isomerize into zwitterions.
  • Minimal salt effects. In other words, the buffer components should not interact or affect ions involved in the biochemical reactions being explored.
  • Minimal effects on the dissociation from changes in temperature and concentration. Usually there is some change in the dissociation with a change in concentration. If this change is small, stock solutions usually can be diluted without changing the pH. However, with some buffers, changes in concentration have more effect on dissociation, and stock solutions cannot be diluted without significantly affecting pH.
    For instance, the pH of Tris decreases approximately 0.1 pH unit per tenfold dilution, and the pH could change dramatically if you dilute a working solution and are at the limits of the optimal buffering range of the Tris (optimal buffering range pH 7.3&ndash9.3 at 20°C). Note that Tris is not one of Good&rsquos buffers.
    Temperature changes can be a problem too. Tris exhibits a large shift in dissociation with a change in temperature. For example, if you prepare a Tris buffer at pH 7.0 at 4.0°C and perform a reaction in that same buffer at 37°C, the pH will drop to 5.95.
    If you have a Tris buffer prepared at 20°C with a pKa of 8.3, it would be an effective buffer for many biochemical reactions (pH 7.3&ndash9.3), but the same Tris buffer used at 4°C becomes a poor buffer at pH 7.3 because its pKa shifts to 8.8.
    So the take-home message: Make the buffer at the temperature you plan to use it, and if your experiment involves a temperature shift, select a buffer with a range that can accommodate any shift in dissociation as a result.
  • Minimal interactions between buffer components and critical reaction components. If a complex forms between the buffer and a required cofactor, say a metal cation like zinc or magnesium, your reaction also might be compromised. For example calcium precipitates as calcium phosphate in phosphate buffers. Not only would any Ca 2+ -requiring reactions be compromised, but the buffering capacity of the phosphate buffer also is affected.
    Having excessive amounts of a chelating agent in the buffer for an enzymatically driven reaction could cause problems (e.g., a high concentration of EDTA in a PCR amplification). Citrate is a calcium chelator, so avoid citrate buffers in situations where calcium concentrations are critical.
    Tris buffers again give us problems because Tris contains a reactive amine group. If you are trying to make Tris buffer that is RNase-free, the amine group on the Tris molecule will react with diethylpyrocarbonate (DEPC), the chemical typically used to pretreat aqueous solutions used for RNA work. So, do not DEPC-treat Tris-containing solutions. HEPES is another buffer that reacts with DEPC. (Remember too, that MOPS is a much better buffer for most RNA work!)
    Take-home message: Buffers are not inert. Be careful which ones you chose.
  • Chemical stability. The buffer should be stable and not break down under working conditions. It should not oxidize or be affected by the system in which it is being used. Try to avoid buffers that contain participants in reactions (e.g., metabolites).
    Some buffers, such as MOPS, must be protected from light, but when they are stored properly they are still extremely useful buffers in biochemical reactions and laboratory protocols like RNA electrophoresis.
  • Light absorption. The buffer should not absorb UV light at wavelengths that may be used for readouts in photometric experiments.
  • Ease of Use. The buffer components should be easy to obtain and prepare.

İyi ve diğerleri. defined several characteristics of buffers for biochemical reactions. No matter what buffer you choose, you need to consider effects of temperature and environment on the buffer and ensure that the buffer is compatible with your system.


Introduction to Single-Cell RNA Sequencing

During the last decade, high-throughput sequencing methods have revolutionized the entire field of biology. The opportunity to study entire transcriptomes in great detail using RNA sequencing (RNA-seq) has fueled many important discoveries and is now a routine method in biomedical research. However, RNA-seq is typically performed in "bulk," and the data represent an average of gene expression patterns across thousands to millions of cells this might obscure biologically relevant differences between cells. Single-cell RNA-seq (scRNA-seq) represents an approach to overcome this problem. By isolating single cells, capturing their transcripts, and generating sequencing libraries in which the transcripts are mapped to individual cells, scRNA-seq allows assessment of fundamental biological properties of cell populations and biological systems at unprecedented resolution. Here, we present the most common scRNA-seq protocols in use today and the basics of data analysis and discuss factors that are important to consider before planning and designing an scRNA-seq project. © 2018 by John Wiley & Sons, Inc.

Anahtar Kelimeler: RNA sequencing gene expression profiling single-cell analysis.


Videoyu izle: Total RNA extraction (Temmuz 2022).


Yorumlar:

  1. Temuro

    Koltuğum solda ve orada oturmalıyım ... Hey, konuşmacı, sakinleşip gerçekten kafanla düşünür müsün :)

  2. Neff

    Sana katılıyorum, açıklama için teşekkürler. Her zaman olduğu gibi, tüm ustaca basittir.



Bir mesaj yaz