Bilgi

MRNA:RNA polimerazı veya mRNA:ribozom kompleksini stabilize eden proteinler var mı?


Aktinomisetler, zengin çeşitlilikte doğal ürünler ve özellikle poliketidler üretme yetenekleriyle bilinirler. Biyosentetik yolları kodlayan genlerin çoğu, 20 kb'ye ulaşabilecekleri için oldukça büyüktür. Bu bakteriler, büyük olasılıkla, bu uzun ORF'lerin verimli transkripsiyonunu ve translasyonunu sağlayacak bir tür mekanizmaya sahiptir. Bu iki yolla yapılabilir: ya mRNA:RNA polimeraz kompleksini stabilize ederek ya da mRNA:ribozom kompleksini stabilize ederek. Herhangi biriniz bakterilerde bu tür mekanizmaları duydunuz mu?


Daha önce protein biyosentezi alanında çalıştığım için bu konu hakkında bilgi aradım ama başarılı olamadım. Bununla birlikte, ribozomların mRNA'dan düşme eğilimi olduğuna karşı bir argüman, durdurma kodonuna ulaşıldıktan sonra ribozom salınımı için çok özel mekanizmadır (burada açıklanmıştır).

Çok uzun mRNA'larla ilgili başka olası sorunlar da vardır:

  • Uzun bir çeviri süresi sırasında (prokaryotik) mRNA'nın olası bozulması. MRNA'nın ömrünü uzatan yapısal özellikler içermesi gerektiğini düşünürdüm.
  • Tüm protein tamamlanmadan önce protein ürününün olası yanlış katlanması ve çökelmesi. Muhtemelen hidrofobik bölgeleri koruyan veya bunu önlemek için alanların katlanmasını teşvik eden şaperon proteinleri olduğunu düşünüyorum.

Dipnot olarak, en uzun mRNA'nın kas proteini olan titin olduğu düşünülmektedir. Bunun sarkomer üzerindeki montajı, örneğin poliketidlerin tipik özelliği olmayacaktır, ancak karşılaşılan diğer problemler benzer olabilir.


Gerçekten de, RNA transkripsiyonunun antiterminatörü olduğuna inanılan nusG adlı bir gen vardır. NusG, RNA uzama hızının artmasına, polimerazın kısa ömürlü duraklama durumlarına geçtiği sürenin azalmasına ve uzun ömürlü stabilize duraklama durumlarının bastırılmasına yol açan RNA polimeraza bağlanır.

NusG'nin doğal ürün keşfi ve biyosentez için önemli olduğu gösterilmiştir:

C. cellulolyticum'da nusG'nin aşırı ekspresyonu, closthioamides B-H86 olarak adlandırılan yedi yeni closthioamide analogunun izolasyonunu sağladı. Bu yeni bileşikler, antibakteriyel ana heksatioamid bileşiğinin budanmış ve kısmen O-ikameli türevleridir, ancak önemli ölçüde daha düşük antibakteriyel aktiviteye sahiptirler.

Ayrıca, myxovirescin (TA) antibiyotiği ekleyen Myxococcus xanthus gen kümesinde nusG benzeri gen bulunur. Bu kümedeki poliketid kodlayan genlerden biri ~27kb uzunluğundadır [3]:

  1. Herbert, K.M. et al. E. coli NusG, RNA polimerazın ileri translokasyonunu teşvik ederek geri izlemeyi engeller ve duraklamasız transkripsiyonu hızlandırır. J. Mol. Biol. 399, 17-30 (2010)

  2. Peter J. Rutledge ve Gregory L. Challis. Sessiz biyosentetik gen kümelerinin aktivasyonu ile mikrobiyal doğal ürünlerin keşfi. Doğa İncelemeleri Mikrobiyoloji 13, 509-523 (2015)

  3. http://mibig.secondarymetabolites.org/repository/BGC0001025/index.html#cluster-1


Birincil transkript

A birincil transkript DNA'nın transkripsiyonu ile sentezlenen ve mRNA'lar, tRNA'lar ve rRNA'lar gibi çeşitli olgun RNA ürünlerini vermek üzere işlenen tek iplikli ribonükleik asit (RNA) ürünüdür. mRNA olarak belirlenen birincil transkriptler, çeviri için hazırlanırken değiştirilir. Örneğin, bir öncü mRNA (ön mRNA), işlendikten sonra bir haberci RNA (mRNA) haline gelen bir birincil transkript türüdür.

Pre-mRNA, transkripsiyon yoluyla hücre çekirdeğindeki bir DNA şablonundan sentezlenir. Pre-mRNA, heterojen nükleer RNA (hnRNA). Pre-mRNA tamamen işlendikten sonra, "olgun haberci RNA" veya basitçe "haberci RNA" olarak adlandırılır. hnRNA terimi genellikle pre-mRNA ile eşanlamlı olarak kullanılır, ancak tam anlamıyla hnRNA, sitoplazmik mRNA olarak sonuçlanmayan nükleer RNA transkriptlerini içerebilir.

Birincil transkriptlerin üretimine katkıda bulunan birkaç adım vardır. Tüm bu adımlar, ökaryotların çekirdeğinde DNA'nın transkripsiyonunu başlatmak ve tamamlamak için bir dizi etkileşimi içerir. Bazı faktörler, birincil transkript üretimini düzenledikleri transkripsiyonun aktivasyonu ve inhibisyonunda kilit rol oynar. Transkripsiyon, birkaç işlemle daha da değiştirilen birincil transkriptler üretir. Bu işlemler 5' başlık, 3'-poliadenilasyon ve alternatif eklemeyi içerir. Özellikle, alternatif ekleme, hücrelerde bulunan mRNA çeşitliliğine doğrudan katkıda bulunur. Birincil transkriptlerin modifikasyonları, bu transkriptlerin rolü ve önemi hakkında daha fazla bilgi arayan araştırmalarda daha fazla incelenmiştir. Birincil transkriptlerdeki moleküler değişikliklere ve transkripsiyon öncesi ve sonrası süreçlere dayanan deneysel çalışmalar, birincil transkriptleri içeren hastalıkların daha iyi anlaşılmasına yol açmıştır.


Shine-Dalgarno Dizisi ve P-Sitesi Kodonu Arasındaki Boşluğu Uzatmak mRNA Translokasyon Hızını Azaltır

mRNA Shine–Dalgarno (SD) dizileri, translasyon uzamasını düzenler.

SD dizisi ve P-sitesi kodonu arasındaki aralayıcıyı genişletmek, mRNA-tRNA-ribozom etkileşimlerini dengesizleştirir.

Aralayıcının SD dizisi ve P-sitesi kodonu arasındaki uzatılması, mRNA translokasyonunu engeller.

16S rRNA'nın 3' ucu ile baz eşleştirme etkileşimleri oluşturarak, açık okuma çerçevelerinin yukarısına yerleştirilmiş mRNA Shine-Dalgarno (SD) dizileri, çevirinin başlatılmasını kolaylaştırır. Protein sentezinin uzama fazı sırasında, intragenik SD benzeri diziler, ribozom çerçeve kaymasını uyarır ve ayrıca mRNA boyunca ribozom hareketini yavaşlatabilir. Burada, SD dizisi ve P-sitesi kodonu arasındaki aralayıcının uzunluğunun, ribozom translokasyon oranını güçlü bir şekilde etkilediğini gösteriyoruz. Aralayıcı uzunluğunun 6 nt'nin üzerine çıkarılması, mRNA-tRNA-ribozom etkileşimlerini dengesizleştirir ve translokasyon hızında 5 ila 10 kat azalma ile sonuçlanır. Bu gözlemler, çeviri sırasında, SD dizisi ve P-bölgesi kodonu arasındaki aralayıcının, mRNA translokasyonunu yavaşlatan ve mRNA çerçeve kaymasını destekleyen yapısal yeniden düzenlemelere uğradığını göstermektedir.


SONUÇLAR

PTB1 ve PTB2'nin memeli PTB'sine homolojisi

Muayene brucei genomunun düzenlenmesine potansiyel olarak katılabilecek birkaç protein ortaya çıkardı. trans-splicing (Liang ve ark. 2003). Önceden tanımlanmış iki protein, DRBD3 ve DRBD4, memeli PTB'sine benzerliğe sahiptir (De Gaudenzi ve diğerleri, 2005). Bu homolojiye dayanarak, DRBD3'ü PTB1 olarak yeniden adlandırdık, bu protein GeneDB'de Tb09.211.0560 olarak açıklanmıştır. DRBD4'ü Tb11.01.5690 olarak açıklamalı PTB2 olarak yeniden adlandırdık. Bu proteinlerin aslında brucei PTB homologlarının yapısını karşılaştırdık brucei insan PTB proteinlerine ( <"type":"entrez-protein","attrs":<"text":"NP_002810.1","term_id":"4506243">> NP_002810.1 ve nPTB <"type ":"entrez-protein","attrs":<"metin":"NP_067013.1","term_id":"10863997">> NP_067013.1). Varsayılan alan yapılarının şematik bir karşılaştırması Şekil 1A'da verilmektedir ve insan proteinlerinin RRM alanlarının kimliği ve benzerliği, PTB1 veya PTB2'ye Şekil 1B'de gösterilmektedir. Proteinlerdeki RRM alanlarının pozisyonları kutularda belirtilmiştir ve oklar her bir alanla ilişkili kalıntıları birbirine bağlar. Şekil 1'de sunulan veriler, RRM 1 ve RRM 2'nin brucei PTB1 çoğunlukla insan proteinleri PTB ve nPTB RRM1, RRM 2 ve RRM 3'ün karşılık gelen RRM'leri ile ilgilidir. T brucei PTB2, insan proteinleri PTB ve nPTB'nin RRM1, RRM3 ve RRM4'üne en çok benzemektedir. brucei PTB2, insan RRM2 homologunu içermez. Proteinin 98� pozisyonlarında, insan proteininin RRM 2'sine en çok benzeyen körelmiş bir RRM alanı vardır. Aslında, etki alanı veritabanı (SMART, FPAM, PROSITE ve INTERPROSCAN programlarına dayalı olarak) bir RRM2 homolog etki alanını tespit edemedi. Yalnızca SMART programını, 98� amino asit dizisiyle kullandığımızda, bu alan, nispeten düşük bir puanla olsa da, bir RRM alanı olarak tanımlandı. Bu farklı etki alanını RRM X olarak adlandırdık.

İnsan PTB'si (PTB1 ve nPTB) ve Tb PTB (PTB1 ve PTB2) arasındaki karşılaştırmanın şematik gösterimi. PTB1 memeli proteinlerinin amino asit dizisi ( <"type":"entrez-protein","attrs":<"text":"NP_002810.1","term_id":"4506243">> NP_002810.1) ve nPTB ( <"type":"entrez-protein","attrs":<"text":"NP_067013.1","term_id":"10863997">> NP_067013.1) tripanozom PTB1 (Tb09.211.0560) ile karşılaştırıldı ) ve PTB2 (Tb11.01.5690) pBLAST (Altschul ve diğerleri 1997) ve Psi BLAST (Altschul ve diğerleri 1997) kullanılarak. Memeli proteinlerinin RRM alanlarının her birinin karşılık gelen tripanozom dizileriyle ilişkisini incelemek için SMART, FPAM, PROSITE ve INTERPROSCAN programları kullanıldı. Memeli RRM alanlarının konumu, Wagner ve Garcia-Blanco'dan (2001) alınan verilere dayanmaktadır. (A) RRM alanları arasında karşılaştırma. Her RRM etki alanı kutuludur. PTB proteinleri arasında ilgili amino asitler oklarla bağlanmıştır ve tam konumları kutunun dışında verilmiştir. (B) RRM alanları arasındaki ilişki (özdeşlik ve benzerlik), aşağıda belirtilen PTB proteinleri arasında gösterilmiştir. A.

Daha sonra, RRM içeren tüm proteinlerin listesinin yanı sıra tüm genomu araştırdık. brucei (De Gaudenzi ve diğerleri, 2005) insan PTB izoformları ile (Şekil 1'de gösterilmiştir). Listenin başında görünen iki protein PTB2 (7e � ) ve PTB1 (3e � ) idi.

RNAi tarafından susturma PTB1 ve PTB2 büyüme için her iki faktörün de gerekli olduğunu gösterir.

PTB proteinlerinin tripanozom RNA metabolizmasındaki rolünü incelemek ve özellikle bu faktörlerin trans- ve cis-splicing, bu genlerin ekspresyonu RNAi tarafından susturuldu. PTB1 ve PTB2 genomdan amplifiye edildi ve stem'in loop yapıları tasarlandı. Yapılar, 479 baz çiftli (bp) bir gövdeden oluşuyordu. PTB1 ve 443-bp'lik bir kök PTB2ve her ikisi de türetilen bir doldurucu taşıdı Pex diziler (Wang ve diğerleri 2000). Bu yapılar, tetrasiklinle düzenlenen bir EP promotörünün akış aşağısında klonlandı ve transfekte etmek için kullanıldı. brucei (29-13) tetrasiklin represörünü ve T7 polimerazı eksprese eder (Wang ve diğerleri 2000). Yapıları ifade eden klonlanmış hücreler, fleomisin üzerinde seçildi. Şekil 2A'nın büyümesini gösterir. PTB1 ve PTB2 susturulmuş hücreler, bu faktörlerin her birinin susturulması üzerine hücre büyümesinde belirgin bir azalma gösterir. Her ikisinin de büyümesine rağmen PTB1 ve PTB2 susturulmuş hücreler inhibe edildi, PTB2 susturulmuş hücreler daha ciddi şekilde etkilenmiştir. Fark, bu iki faktör tarafından farklı mRNA alt kümelerinin işlenmesi veya stabilitesi üzerindeki etkiden kaynaklanabilir (aşağıya bakınız). Susturulmuş hücrelerde karşılık gelen mRNA'lar ve proteinlerdeki azalma, Şekil 2, B ve C'de sunulmaktadır. Sonuçlar, dsRNA üretiminin uyarıldığını ve karşılık gelen mRNA'ların seviyesinde %80�% azalma olduğunu gösterir.

(A) PTB1 ve PTB2 önemli genlerdir. Uyarılmamış hücrelerin (−Tet) büyümesi, dsRNA üretimi (+Tet) için uyarılan hücrelerle karşılaştırıldı. İndüklenmemiş kültürlerdeki hücre sayısı siyah elmaslarla indüklenmiş kültürlerdeki sayı gri karelerle gösterilir. (B) kuzey analizi PTB1 ve PTB2 RNAi susturma üzerine. RNA, indüklenmemiş hücrelerden ve 3 günlük indüksiyondan sonra hücrelerden hazırlandı. Toplam RNA (20 μg), bir %1.2 agaroz𠄲.2 M formaldehit jeli üzerinde ayrıldı. RNA lekelendi ve iki gene özel rastgele etiketlenmiş bir prob ile hibridize edildi. 7SL RNA seviyesi (eşit yükleme için kontrol), anti-sens 7SL RNA oligonükleotidi ile hibridizasyon yoluyla saptandı. Transkriptlerin kimliği belirtilir. (C) PTB proteinlerinin Western analizi (sol). Bütün hücre özütü (30 μx003bcg) %12 SDSx02013poliakrilamid üzerinde ayrıldı ve anti-PTB antikorları (1:10.000 seyreltilmiş) kullanılarak Western analizine tabi tutuldu. Moleküler kütle işaretleri belirtilmiştir. Susturma üzerine PTB proteinlerinin seviyesinin Western analizi (sağ). İndüklemeden 3 gün sonra uyarılmamış ve susturulmuş hücrelerden 2 hücreden toplam protein özütleri %12 SDS poliakrilamid jelleri üzerinde ayrıldı ve anti-PTB1 ve anti-PTB2 antikorları (1:10.000 seyreltilmiş) kullanılarak Western analizine tabi tutuldu. hnRNP D0 seviyesi, eşit yükleme için bir kontrol olarak kullanıldı.

Malzemeler ve Yöntemler'de tarif edildiği gibi PTB1 ve PTB2'ye karşı antikorlar yükseltildi ve susturma üzerine protein seviyesindeki azalmayı incelemek için kullanıldı. Antikorların özgüllüğü kullanılarak incelenmiştir. brucei tam hücre özleri ve Şekil 2C'deki (sol panel) sonuçlar, her antikorun yalnızca tek bir polipeptidi tanıdığını gösterir. Susturma üzerine karşılık gelen proteinin tamamen eliminasyonu gözlemlendi (Şekil 2C, sağ panel). Bu sonuçlar, sessizliğin PTB1 ve PTB2 çok verimli olduğunu ve bu faktörlerin yaşam için gerekli olduğunu söyledi.

PTB1 ve PTB2'nin hücresel lokalizasyonu ve biyokimyasal fraksiyonasyonu

PTB proteinlerinin lokalizasyonu, PTB1'in GFP'ye kaynaştırılmasıyla veya PTB2'ye karşı antikorlar kullanılarak immünofloresan ile belirlendi. Sonuçlar (Şekil 3A), tüm parazitin (uzun pozlama) ve çekirdeğin kısa pozlamanın (sol köşe) görüntülerini gösterir. Veriler, her iki proteinin de esas olarak çekirdekte "benekler" şeklinde lokalize olduğunu, ancak sitoplazmada da soluk boyama gözlemlendiğini gösteriyor.

(A) Hücrede PTB1 ve PTB2'nin lokalizasyonu. (Üst panel) GFP-PTB1 yapısını ifade eden hücrelerin görüntülenmesi. Hücreler %4 formaldehit içinde sabitlendi (panel a) PTB1-GFP'nin floresansı (panel B) DAPI ile boyanmış çekirdekler (C) Panellerin DIC birleştirmesi a ve B. Görüntüler uzun pozlamanın ardından elde edildi. Nükleer alanın genişlemesi çerçevelenir ve daha kısa pozlama kullanılarak elde edilir. (Daha düşük paneli) PTB2'nin immünofloresansı. Hücreler, 25 dakika boyunca %2 paraformaldehit ile sabitlendi, Malzemeler ve Yöntemler'de tarif edildiği gibi antikorlarla inkübe edildi ve bir FITC-konjüge edilmiş ikincil antikor tarafından tespit edildi. (Panel a) PTB2 proteininin floresansı (panel B) DAPI ile boyanmış çekirdekler (panel C) Panellerin DIC birleştirmesi a ve B. Görüntüler uzun pozlamanın ardından elde edildi. Nükleer alanın genişlemesi çerçevelenir ve daha kısa pozlama kullanılarak elde edilir. (B) PTB proteinleri ile bağlantılı komplekslerin boyutunu belirlemek için ekstrelerin FPLC ile fraksiyonlanması. Bütün hücre özleri, ebeveyn hücrelerden veya BB2 etiketli Prp31 proteinini ifade eden hücrelerden hazırlandı (Liang ve diğerleri, 2006). Ekstrakt hazırlama ve kolon kromatografisi Malzemeler ve Yöntemler bölümünde anlatılmıştır. Proteinler, ilgili antikorlar (anti-BB2, anti PTB [bu çalışma], anti-U2AF65 [Dr. Mariano Levin, Genetik Mühendisliği ve Moleküler Biyoloji Enstitüsü (INGEBI) ve Ulusal Bilim Konseyi tarafından sağlanır) kullanılarak Western analizine tabi tutuldu ve Teknoloji Araştırması (CONICET)]). İncelenen proteinlerin kimliği belirtilir. İşaretleyici proteinlerin, BSA (66 kDa) ve β-amilazın (200 kDa) elüsyon pozisyonları belirtilmiştir. (C) PTB proteinlerinin birlikte immünopresipitasyon. 5 hücreden ekstrakt hazırlandı ve Malzemeler ve Yöntemler'de tarif edildiği gibi antikorlarla immünopresipitasyon yapıldı. Numuneler, PTB1 ve PTB2 antikorları kullanılarak Western analizine tabi tutuldu. PTB1 ile immüno-çökeltilen proteinler, anti-PTB2 ile problanmıştır ve bunun tersi de geçerlidir. Toplam hücre özü ve süpernatan (%5) bütün boncukların yanında analiz edildi.

Daha sonra, vahşi tipten türetilen ekstraktları fraksiyonlara ayırarak faktörlerin dağılımını inceledik. brucei prosiklik aşamada veya otantik bölgesinden eksprese edilen bir BB2 etiketli PRP31 proteini taşıyan hücrelerden ekstraktlar (Liang ve diğerleri 2006). Özler, düşük tuz koşulları (50 mM KCl) altında hazırlandı ve bir Superdex S-200 FPLC kolonu üzerinde fraksiyonlandı. Bu faktörlerin tepe fraksiyonları farklıydı (Şekil 3B) PTB1 en çok 22� fraksiyonlarında, PTB2 ise 24� fraksiyonlarında bulundu. Farklı dağılımları nedeniyle, bu faktörler büyük olasılıkla birbirleriyle etkileşime girmezler. Durumun gerçekten böyle olduğunu doğrulamak için, immünopresipitasyon deneylerinde bu proteinlerin her birine karşı antikorlar kullanıldı. Şekil 3C'deki sonuçlar, PTB1'e karşı antikorların PTB1'i immüno-çökelttiğini ancak PTB2'yi değil, PTB2'ye karşı antikorların PTB2'yi çökelttiğini ancak PTB1'i çökelttiğini gösterir. İlginç bir şekilde, PTB1 ve PTB2 ayrıca PRP31 veya U2AF65 gibi genel ekleme faktörlerinin birçoğu ile birlikte parçalanmazlar. Bununla birlikte, PTB1 veya PTB2 taşıyan komplekslerin boyutu 66�-kDa aralığındadır ve bu faktörlerin muhtemelen diğer ekleme veya protein faktörleriyle ilişkili olduğunu düşündürür. Bununla birlikte, PTB1 ve PTB2 ile oluşturulan kompleksler, PRP31 ve U2AF65 ile ilişkili olanlardan önemli ölçüde daha küçüktür.

PTB1 ve PTB2, susturmaları SL RNA'nın kararlı durum seviyesini ve onun yeni ortaya çıkan transkripsiyonunu etkilemesine rağmen, bazal ekleme faktörleri değildir.

Etkileyen bazal ekleme faktörlerinin susturulmasının daha önce olduğunu göstermiştik. trans- tüm mRNA'ların eklenmesi, eklemede kullanılmadığından ve dolayısıyla hücrede biriktiğinden SL RNA seviyelerinin yükselmesine neden olur (Mandelboim ve diğerleri 2003 Liu ve diğerleri 2004 Liang ve diğerleri 2006 Tkacz ve diğerleri 2007). PTB1 ve PTB2 proteinlerinin bazal birleştirme faktörleri olup olmadığını incelemek için, SL RNA'nın kararlı durum seviyesi üzerindeki etki, PTB susturma işleminin ardından primer uzantısı ile incelendi. Şekil 4A'da sunulan sonuçlar, her iki faktörün de susturulmasının, SL RNA'nın kararlı durum seviyesini 30'da %30 ve %60 oranında azalttığını göstermektedir. PTB1 ve PTB2 sırasıyla susturulmuş hücreler. Cap-4 nükleotidleri üzerindeki kademeli duraklar, indüklenmemiş hücrelerde ve PTB1 veya PTB2 tükenmiş hücrelerde aynı olduğundan, SL RNA'nın kapatılması üzerinde hiçbir etki gözlenmedi. Eğer incelemek için trans-splicing, SL RNA'nın indirgenmesiyle aynı derecede etkilenir veya daha şiddetli bir şekilde, Y yapısı ara maddesinin seviyesi, SL RNA'nın intron kısmına tamamlayıcı bir oligonükleotit kullanılarak incelendi. Eğer trans-Splicing'in ilk adımında ekleme etkilenir, Y yapısının seviyesi azalır, ancak ikinci adımda reaksiyon etkilenirse Y yapısı birikir. Şekil 4B'de gösterilen sonuçlar, Y yapısı ara maddesinin seviyelerindeki azalmanın (sırasıyla PTB1 ve PTB2 için %39 ve %58), kararlı durum SL RNA seviyesindeki azalmayı yansıttığını ve ikisinin de PTB1 veya PTB2 aşağıdakileri etkiler: trans-tüm mRNA'ların eklenmesi, Y yapısının seviyesindeki azalma, susturulmuş hücrelerde SL RNA seviyesindeki azalma ile iyi bir şekilde ilişkilidir. SL RNA ve Y yapısı ara maddesindeki azalmanın derecesini ölçen deneyler üç kez tekrarlandı ve bu deneylerin sonuçları Şekil 4C'de sunuldu. Bu noktada, bu faktörlerin durumu etkileyebileceği ihtimalini göz ardı edemeyiz. trans- sadece bir mRNA alt kümesinin eklenmesi, ancak veriler, ne PTB1 ne de PTB2'nin, Y yapısı ara ürününün seviyesini etkileyen genel bir ekleme faktörü olmadığını göstermektedir. PTB2 susturma nedeniyle oluşan kusurlar, PTB1 için gözlemlenenlerden daha şiddetlidir. Her iki durumda da susturma proteinlerin tamamen ortadan kaldırılmasıyla sonuçlandığından, bu farklılıklar farklı susturma derecelerine atfedilemez.

Aradaki SL RNA ve Y yapısı seviyeleri PTB1 ve PTB2 susturma. (A) SL RNA seviyesi. Toplam RNA, indüksiyondan önce (−Tet) ve 3 günlük indüksiyondan (+Tet) sonra PTB yapılarını taşıyan hücrelerden hazırlandı. Primer uzatma, SL RNA'nın 3'x02032 ucuna tamamlayıcı radyoetiketli oligonükleotit ile 10 x003bcg RNA üzerinde gerçekleştirildi (20708, Ek Tablo S-1'de listelenmiştir). cDNA, %6 dizileme jeli üzerinde ayrıldı. Farklı kapak nt'den kaynaklanan durdurmaların konumu, üzerinde gösterilir. sol. Numunedeki RNA miktarını kontrol etmek için U3 ile primer uzatma kullanıldı. (B) Y yapısının ara seviyesini belirlemek için astar uzantısı. aynı A ancak 9091 primeri kullanıldı (S-1'de listelenmiştir). (C) SL RNA ve Y yapısının kantitatif analizi PTB susturma. İndüklenmemiş hücrelerdeki SL RNA ve Y yapısının seviyesi gri çubuklarla gösterilir ve üç bağımsız susturma deneyinden elde edilen aynı değerler beyaz çubuklarda verilir ve standart sapma gösterilir.

Daha sonra, susturma sırasında SL RNA seviyesindeki azalmanın, SL RNA'nın transkripsiyon kapanmasından kaynaklanıp kaynaklanmadığını inceledik. Bu amaçla geçirgen hücre sistemi kullanılmıştır (Tschudi ve Ullu 1990 Ullu ve Tschudi 1990). SL RNA, bu sistemdeki başlıca radyoetiketli transkripttir. Şekil 5'teki sonuçlar, yeni kopyalanan SL RNA seviyesinde %54 ve %79 azalma olduğunu göstermektedir. PTB1 ve PTB2 sırasıyla susturma.

Yeni oluşan transkripsiyon PTB1 sessiz hücreler ve PTB2 sessiz hücreler Geçirgen hücreler, Malzemeler ve Yöntemlerde tarif edildiği gibi, susturmanın üçüncü gününde aynı sayıda indüklenmemiş ve PTB susturulmuş hücreden hazırlandı. Etiketli RNA, %6'lık bir denatüre edici jel üzerinde fraksiyonlandı. RNA'ların kimlikleri belirtilir. SL RNA'nın daha kısa bir maruziyeti, ekranda gösterilir. sağ.

PTB proteinlerinin SL RNA seviyesi üzerindeki etkisi, ya doğrudan bir etkiden ya da dolaylı bir etkiden kaynaklanabilir. Örneğin, PTB proteinleri, promotör veya SL RNA transkripsiyon kompleksi ile etkileşime girebilir. PTB proteinleri ayrıca Sm proteinleri ile birleşmeden önce yeni oluşan SL RNA'ya bağlanabilir ve dolayısıyla yeni oluşan SL RNA'nın stabilitesini etkileyebilir. Alternatif olarak, SL RNA transkripsiyonu üzerindeki etki dolaylı bir etki olabilir ve SL RNA transkripsiyonu için gerekli olan proteinlerden biri, seviyesi PTB susturulmuş hücrelerde düzenlenen (azaltılmış) kısa ömürlü bir RNA tarafından kodlanabilir.

PTB'nin SL RNA promotörüne olası doğrudan bağlanmasını saptamak için, PTB proteinlerine karşı antikorlar kullanılarak bir ChiP tahlili yapıldı. Sonuçlar (veriler gösterilmemiştir), PTB'nin SL promotörünün DNA'sı ile doğrudan ilişkili olmadığını göstermektedir. Daha sonra, yeni oluşan SL RNA seviyesindeki azalmanın, bu proteinlerin yeni oluşan SL RNA'ya bağlanmasının bir sonucu olup olmadığını, PTB1 proteininin geçirgen hücrelerde sentezlenen SL RNA'ya in vitro UV çapraz bağlanmasıyla olup olmadığını inceledik. Sonuçlar (veriler gösterilmemiştir), tam hücre özütleri kullanıldığında böyle bir çapraz bağlanmanın gözlenemeyeceğini göstermektedir. Bu sonuçlar, PTB'nin SL RNA seviyeleri üzerindeki etkisinin muhtemelen birincil olmadığını ve ya SL RNA transkripsiyonunda veya yeni oluşan SL RNA'nın stabilizasyonunda işlev gören henüz tanımlanmamış bir faktörün aşağı regülasyonundan kaynaklanabileceğini göstermektedir.

PTB1 ve PTB2 susturulmuş hücrelerden izole edilen RNA'nın mikroarray analizi, transkriptom üzerinde farklı etkiler önerir

Şekil 4'te sunulan sonuçlar, ne PTB1 ne de PTB2'nin tüm mRNA'nın eklenmesini etkileyen genel bir ekleme faktörü olmadığını gösterdiğinden, PTB1 veya PTB2 için tükenmiş hücrelerde hangi mRNA'ların spesifik ve farklı şekilde etkilendiğini belirlemeye çalıştık. 3 günlük susturma işleminden sonra hücrelerden RNA hazırlandı ve indüklenmemiş hücrelerden RNA ile karşılaştırıldı.

Üç biyolojik kopya gerçekleştirildi ve hibridize edildi. brucei Malzemeler ve Yöntemler bölümünde açıklanan mikrodiziler. Veriler, GeneSpring GX yazılımı (Agilent Technologies) kullanılarak analiz edildi. Boya yanlılığını düzeltmek için düşük normalizasyon yapıldı ve normalleştirilmiş veriler, ekspresyonu önemli ölçüde görünen genleri tanımlamak için kullanıldı (P değeri π.05) yukarı veya aşağı regüle edilir, en az 1,5 kat keyfi bir kesme ile. Bu tür genlerin bir listesi Ek Tablo S-2'de verilmektedir. Gen ekspresyonundaki farklılıkları görselleştirmek için PTB susturulmuş hücreler, bir benzerlik ölçüsü olarak Pearson korelasyonu kullanılarak seçilen genler üzerinde ortalama bağlantı hiyerarşik kümelemesi yapıldı ve uyarılmamış ve susturulmuş hücreler arasındaki transkript seviyesindeki farkı temsil eden bir ısı haritası oluşturuldu (Şekil 6). Sonuçlar, PTB1 ve PTB2'nin transkriptomu farklı şekilde etkilediğini ve bu proteinlerin mRNA'ların farklı alt kümelerini bağladığını düşündürmektedir.

İndüklenmemiş hücrelere göre PTB1 ve PTB2 susturulmuş hücreler arasında farklı şekilde eksprese edilen genlerin ısı haritası. Kontrolden ϡ.5 kat farklılık gösteren transkriptler (P değer π.05) analiz için seçilmiştir. Her sütun, üç biyolojik kopyanın ortalamasını temsil eder. Isı haritası, ortalama bağlantı hiyerarşik kümeleme algoritması ve benzerlik ölçüsü olarak Pearson korelasyonu kullanılarak Genspring GX yazılımı (Agilent teknolojileri) kullanılarak oluşturulmuştur. Diyagram, aşağıdaki renk skalasına göre diferansiyel ifade seviyesini temsil eder: kırmızı, yukarı regüle edilmiş genler mavi, aşağı regüle edilmiş genler.

PTB1 ve PTB2 sadece eklemeyi değil, aynı zamanda mRNA stabilitesini de etkilediğinden (aşağıya bakınız), hem 5'x02032 hem de 3'x02032 uçlarında kodlama sekansını çevreleyen sekanslarda polipirimidin yolları bakımından zengin sekansların varlığı için düzenlenmiş genlerin listesi tarandı. ORF'nin. Bu amaçla, “list download” aracı (http://www.genedb.org) kullanılarak GeneDB'den her bir genin 300 bp yukarı akış ve 500 bp aşağı akış dizileri alındı. Arama, şirket içinde yazılmış bir C dili programı kullanılarak yapıldı (istek üzerine yazarlardan temin edilebilir).

Program üç tip diziyi aramak için tasarlanmıştır: (1) sadece bir C'ye izin verilen en az on T'nin bir uzantısı olarak tanımlanan optimal bir polipirimidin yolu (bir ekleme sinyali olarak) taşıyan diziler (Benz ve diğerleri 2005) ( 2) T ve C uzantılarını taşıyan ve T'nin daha bol olduğu ve ayrıca PTB bağlanma bölgeleri (TCTT ve/veya TCTCT) içeren polipirimidin yolları ve (3) PTB dizilerinden yoksun optimal olmayan polipirimidin yolları (birleştirme sinyalleri olarak) ve bu T, dizinin en az %59'unu oluşturur (Benz ve diğerleri, 2005). Kontrole kıyasla PTB1 susturulmuş hücrelerde yüz yetmiş genin aşağı regüle edildiği ve 146 genin 1,5 kattan fazla yukarı regüle edildiği bulundu. Bunlardan, aşağı regüle edilmiş genlerin 49'u ve yukarı regüle edilmiş genlerin 36'sı, yukarı akış bölgelerinde bir PTB bağlama bölgesi içeren geleneksel olmayan bir polipirimidin yolu (PPT) bölgesi taşır ve Ek Tablo S-3'te sunulur. Kontrole kıyasla PTB2 susturulmuş hücrelerde 150 gen aşağı regüle edildi ve 214 gen 1.5 kattan fazla yukarı regüle edildi. Bu genlerden, aşağı regüle edilmiş genlerden 46'sı ve yukarı regüle edilmiş genlerden 51'i, yukarı akış bölgelerinde PTB bağlama dizileri içeren kanonik bir PPT bölgesinden yoksundur ve Ek Tablo S-4'te sunulmaktadır. Ek Tablolar S-3 ve S-4'te listelenen genler, büyük olasılıkla ekleme düzeyinde düzenlenen genlerdir, kalan transkriptler ise büyük olasılıkla mRNA stabilitesi düzeyinde düzenlenir (aşağıya bakınız). Herhangi bir transkriptin hem PTB1 hem de PTB2 tarafından düzenlenip düzenlenmediğini incelemek için bir Venn Şeması hazırlandı, sonuçlar iki PTB proteini tarafından düzenlenen transkriptler arasında önemli bir örtüşme olmadığını gösteriyor (veriler gösterilmemiştir), bu da her faktörün farklı bir transkript alt kümesine bağlandığını düşündürmektedir. .

Mikrodizi verilerinin doğrulanması

Mikrodizi tarafından elde edilen sonuçları doğrulamak için, yukarı veya aşağı regüle edilmiş potansiyel PTB1 ve PTB2 substratlarının Ek Tablo S-2'deki listeden birkaç transkript seçildi. cDNA, rastgele primerler kullanılarak RNA'dan hazırlandı. Her numunedeki RNA miktarı, PTB susturulmuş hücrelerde seviyesi değiştirilmeyen bir transkript olan tubulin seviyesi incelenerek kalibre edildi. Adaylar, susturma sırasındaki kat değişimlerine (2.3 kattan fazla) göre seçildi ve sadece bol mRNA'lar (mikrodizi deneylerinde hibridizasyon yoğunluğuna dayalı olarak) analiz edildi. Ayrıca genomda açık bir nota sahip olan genleri seçmeyi tercih ettik. Şekil 7A'daki sonuçlar, beş yukarı regüle edilmiş transkriptin ve dört aşağı regüle edilmiş transkriptin geçerliliğini özetlemektedir. PTB1 susturulmuş hücreler ve Şekil 7B'dekiler, dört yukarı-düzenlenmiş transkript ve beş aşağı-regüle edilmiş transkripti özetlemektedir. PTB2 sessiz hücreler Bu sonuçlar, mikrodizi verilerinin gerçekten de PTB susturmanın bir sonucu olarak transkriptomdaki gerçek değişiklikleri yansıttığını ve bu transkriptlerin bir sonucu olarak aşağı regüle edildiğini veya yukarı regüle edildiğini doğrulamaktadır. PTB tüketme. Bu farklı transkriptler üzerindeki etkinin özgüllüğünü göstermek için, PTB1 substratlarının seviyesi, PTB2 susturulmuş hücrelerde ve bunun tersi de incelenmiştir. Sonuçlar, PTB proteinlerinin her birinin susturulmasının spesifik olarak benzersiz bir transkript alt kümesini etkilediğini ve yine bu faktörlerin farklı substratlar üzerinde etki ettiği fikrini desteklediğini göstermektedir.

RT-PCR ile mikrodizi verilerinin doğrulanması. cDNA, Malzemeler ve Yöntemler'de açıklandığı gibi, uyarılmamış hücrelerden (−Tet) veya 3 gün susturma (+Tet) sonrasında hücrelerden türetilen toplam RNA'dan (1 μx003bcg) hazırlandı. cDNA'nın bir alikotu (1/50 ila 1/100), gene özgü primerler (Ek Tablo S-1'de listelenmiştir) kullanılarak PCR ile büyütüldü. PCR reaksiyonu, %1 agaroz jelleri üzerinde analiz edildi ve etidyum bromür boyaması ile görselleştirildi. Örnekteki tubulin miktarı ölçülerek cDNA miktarı kalibre edildi. Her reaksiyon için cDNA'yı seyrelterek amplifikasyonun doğrusallığını belirledik. Sunulan genler, susturma sırasında önemli ölçüde yukarı regüle edilen veya aşağı regüle edilenlerdir (mikrodizi verilerinde en az 2.3 kat). Bir kontrol olarak, bu transkriptlerin seviyesi, diğer PTB için susturulmuş hücrelerden ekstrakte edilen RNA'da incelendi. (A) Yukarı regüle edilmiş ve aşağı regüle edilmiş genler PTB1 susturulmuş hücreler (B) de olduğu gibi A, ama için PTB2 sessiz hücreler GeneDB'ye dayalı olarak her bir genin erişim numarası ve ek açıklaması sunulmaktadır.

Daha sonra, aşağı veya yukarı regülasyonun, bu faktörlerin aynı kökenli mRNA'lara bağlanmasının doğrudan bir sonucu olup olmadığını inceledik. PTB'nin bağlanması, transkriptlerin PTB1 ve PTB2'ye karşı antikorlar kullanılarak immüno-çökeltilmesiyle incelenmiştir. mRNA'nın protein etkileşimlerini stabilize etmek için hücreler UV ışınlarına maruz bırakıldı, hücrelerden ekstreler hazırlandı ve immüno-çökeltilmiş RNA, ilgili transkriptleri saptamak için RT-PCR'ye tabi tutuldu. Kontrol olarak preimmun serum kullanıldı. Şekil 8'de sunulan sonuçlar, PTB1'in (Şekil 8A) ve PTB2'nin (Şekil 8B), susturma sırasında seviyeleri değişen aynı kökenli transkriptlere seçici bağlanmasını gösterir. Test edilen genlerden üçünün, üçten ikisinde (Tb927.4.5390 ve Tb927.6.2640) yanlış pozitif olduğu kanıtlandı, tükenme sırasındaki değişiklikleri de RT-PCR ile doğrulanmadı. Bağlanmanın özgüllüğünü doğrulamak için, PTB1 substratları, anti-PTB2 antikorları tarafından immüno-çökeltilen mRNA'lar arasında incelenmiştir ve bunun tersi de geçerlidir. Sonuçlar, hiçbir PTB1 substratı, anti-PTB2 antikorları kullanılarak immüno-çökeltilmediğinden ve bunun tersi olduğundan, tam bir özgüllük gösterir.

Aynı kökenli antikorlarla immünopresipitasyon yoluyla PTB1 ve PTB2 substratlarının tanımlanması. Malzemeler ve Yöntemler'de açıklandığı gibi 5 dakikalık UV çapraz bağlamasından sonra 5 109 ebeveyn hücreden tam hücre özütü hazırlandı. İmmünopresipitasyon, anti-PTB1, anti-PTB2 veya kontrol-ön bağışıklık serumu ile yapıldı. RNA, boncuklardan ayrıştırıldı ve toplam RNA (girdi) ile birlikte RT-PCR ile analiz edildi. Spesifik genlerin amplifikasyonu için kullanılan primerler, Ek Tablo S-1'de listelenmiştir. GenDB'ye dayalı genlerin erişim numarası ve açıklamaları sunulmaktadır. Bir kontrol olarak, PTB2 substratları, PTB1 immüno-çökeltilmiş mRNA'larda incelenmiştir ve bunun tersi, bu kontrol transkriptleri yıldızlarla işaretlenmiştir.

Her transkript için, mRNA seviyesindeki değişiklik bir veya daha fazla mekanizmadan kaynaklanabilir. PTB, mRNA'nın transkripsiyonunu, mRNA'nın stabilitesini veya pre-mRNA'nın eklenmesini etkileyebilir. Susturulmuş hücrelerde transkript seviyesindeki bir azalma, PTB'nin transkripsiyon, ekleme veya transkript stabilizasyonu için gerekli olduğunu düşündürebilir. Ancak, transkript düzeyinin de ikincil etkilerden etkilenme olasılığını göz ardı edemeyiz. Örneğin, PTB hedeflerinden biri, kendi başına, diğer substratların seviyesini etkileyen bir RNA bağlayıcı protein olabilir. Bununla birlikte, genomda, PTB genlerinden başka bir geni susturabilecek ve dolayısıyla bir hedef dışı etki oluşturabilecek susturma yapısında mevcut dizilerle tam bir eşleşme yoktur.

Transkripsiyonel düzenleme (başlangıç ​​seviyesinde) tripanozomlardaki gen düzenlemesinde önemli bir rol oynamasa da, PTB susturma, SL RNA'nın transkripsiyonunu etkiledi. etkisinin incelenmesi bu nedenle ilgi çekiciydi. PTB protein kodlayan genlerin transkripsiyonunda susturma ve bunu polimeraz I veya III tarafından kopyalanan protein kodlamayan genlerin transkripsiyonuyla karşılaştırın. PTB, DNA'ya bağlanabilir ve transkripsiyon uzamasını etkileyebilir. olup olmadığını incelemek için PTB susturma transkripsiyonu etkiler, geçirgen hücrelerde sentezlenen yeni oluşan RNA, PTB ile susturulmuş hücrelerde değişen seviyeleri gösteren transkriptlerin PCR ürünlerini taşıyan yarık lekeleri araştırmak için kullanıldı. Sonuçlar (Şekil 9) göstermektedir ki, her ikisinde de PTB1 susturulmuş hücreler (Şekil 9A) ve PTB2 susturulmuş hücrelerde (Şekil 9B), protein kodlayan mRNA'ların yeni oluşan transkripsiyonu üzerindeki etkisi, SL RNA transkripsiyonu üzerindeki etkisi ile karşılaştırıldığında çok mütevazıydı. Susturma sırasında (oklarla işaretli) seviyeleri yükselen transkriptler için transkripsiyonda herhangi bir değişiklik gözlemlenmediğine dikkat edin. Sonuçlar ayrıca, en önemli etkinin polimeraz II transkriptleri için görülmesi ve rRNA (polimeraz I tarafından kopyalanır) veya U2 snRNA'nın transkripsiyonu üzerinde hiçbir etki gözlemlenmemesi nedeniyle, transkripsiyon kapatmasının büyük olasılıkla polimeraz II'ye özgü olduğunu göstermektedir. polimeraz III tarafından tripanozomlarda kopyalanır (Nakaar ve diğerleri 1994). Bununla birlikte, PTB'nin genom boyunca belirli DNA dizilerine bağlanma ve bu tür lokusların transkripsiyon uzamasını etkileme olasılığını göz ardı edemeyiz. Bununla birlikte, PTB substratları için sınırlı ekranımızda bu tür lokusları tespit edemedik.

Yeni oluşan RNA sentezi PTB1 ve PTB2 sessiz hücreler Geçirgen hücreler, Malzemeler ve Yöntemlerde açıklandığı gibi 3 gün PTB1 ve PTB2 susturma (+Tet) sonrasında uyarılmamış hücrelerden (−Tet) ve hücrelerden hazırlandı. RNA, belirtildiği gibi genleri kodlayan DNA'yı içeren bir yarık lekesi ile hibridizasyon için kullanıldı. (A) PTB1 (B) PTB2. Genlerin kimliği, erişim numaralarıyla verilir. Kontrol olarak memeli SIRT geni kullanıldı. Diziye dayalı olarak yukarı regüle edilmiş genler oklarla gösterilmiştir.

PTB1 ve PTB2, farklı mRNA setlerinin stabilitesini etkiler

Memelilerde PTB'nin 3'lü UTR'ye bağlanarak mRNA'nın stabilitesini yönettiği gösterilmiştir (Soderberg ve diğerleri 2002 Kosinski ve diğerleri 2003 Tillmar ve Welsh 2004). PTB1 ve PTB2'nin substratlarının stabilitesini benzer şekilde düzenleyip düzenlemediğini incelemek için PTB1 ve PTB2 hedef transkriptlerinin yarı ömrü incelendi. İki PTB1 hedefi seçildi: ifadesi PTB susturma üzerine aşağı regüle edilen bir amino asit taşıyıcısını kodlayan AATP11 (Tb927.4.4730) ve seviyesi yukarı regüle edilen varsayımsal bir protein olan HP2690 (Tb11.01.2690) kodlayan bir transkript susturma sırasında (Şekil 7A). PTB2 için aşağıdaki transkriptler seçildi: AQP3 aşağı regüleli bir su kanalı aquaporini (Tb927.6.1520) kodlamak ve PDE (piruvat dehidrojenaz Tb10.389.0890) seviyesi yukarı regüle edilmiştir. PTB2- susturulmuş hücreler (Şekil 7B). Susturma sırasında mRNA'nın yarı ömrünü ölçmek için indüklenmemiş hücreler ve indüksiyondan 3 gün sonra hücreler konsantre edildi. Birkaç dakikalık iyileşmeden sonra hücreler, inhibe ettiği gösterilen sinefungin ile tedavi edildi. trans-Splicing ve mRNA üretiminin kapatılmasına yardımcı olmak için bu ajan, mRNA'ların yarı ömrünü belirleyen deneylerin kalitesini artırır (Colasante ve diğerleri 2007). 10 dakika boyunca hücrelere sinefungin eklendi, ardından aktinomisin D eklendi ve belirtilen zaman noktalarında hücrelerden RNA özü çıkarıldı. Northern analizi belirtilen problar kullanılarak yapıldı.Aynı membranlar, 7SL RNA'ya özgü bir prob ile hibridize edildi. mRNA'ların seviyesi dansitometri ile ölçüldü ve yarı ömür, 7SL RNA seviyesine normalize edilerek hesaplandı. Şekil 10A'da görülebileceği gibi, yarı ömrü AATP11 mRNA 43 dakikadan 22 dakikaya düşürülürken, yarı ömrü HP2690 PTB1 susturulmuş hücrelerde 10 dakikadan 100 dakikaya çıkarıldı. yarı ömrü AQP3 PTB2 susturulmuş hücrelerde 80 dakikadan 20 dakikaya düşürüldü ve PDE'ninki 40 dakikadan 75 dakikaya çıkarıldı (Şekil 10B). Şekil 10'daki sonuçlar üç kez tekrarlandı ve her bir zaman noktası, karşılık gelen standart sapması ile gösterilmektedir. Bu sonuçlar, her iki PTB proteininin, mRNA'ların stabilitesini, onları stabilize ederek veya destabilize ederek etkilediğini göstermektedir. İlginç bir şekilde, kat değişimi AATP11 susturulmuş hücrelerdeki seviyeleri, karşılık gelen mRNA'nın yarı ömründe gözlemlenen değişikliği aşıyor, bu da PTB'nin düzenlemesini ek mekanizma(lar) yoluyla bu transkript üzerinde uygulayabileceğini düşündürüyor (aşağıya bakınız).

PTB1 ve PTB2, mRNA'ların yarı ömrünü düzenler. mRNA seviyelerinin kuzey analizi. İndüklenmemiş ve PTB1'i tükenmiş hücreler (indüksiyondan 3 gün sonra) sinüsfungin (2 µx003bcg/mL) ve 10 dakika sonra Actinomycin D (30 µx003bcg/mL) ile tedavi edildi. RNA, şeritlerin üzerinde belirtilen zaman noktalarında hazırlandı, bir %1.2 agarozformaldehit jeli üzerinde ayrıldı ve belirtilen gene spesifik problarla Northern analizine tabi tutuldu. Eşit yüklemeyi kontrol etmek için 7SL RNA kullanıldı. (A) PTB1 (B) PTB2. Şekilde gösterilen hibridizasyon sinyalleri üst panel dansitometri ile ölçüldü. Bozunma eğrileri lekelerin altında gösterilir ve yarı ömür kesik çizgilerle gösterilir. İndüksiyonun yokluğunda (−Tet) bozunma, indüksiyon üzerine siyah elmaslarla (+Tet), gri karelerle gösterilir.

Bu sonuçlar, transkriptlerin, iki ila 10 kat arasında değişen düzenleme genliği ile farklı şekilde etkilendiğini göstermektedir. Bununla birlikte, PTB1 ve PTB2 proteinleri, PTB bağlanma bölgeleriyle zenginleştirilmiş bir PPT alanını tanımalıdır, bu nedenle aynı kökenli transkriptlerin bu tür siteleri içermesi beklenir ve bir konsensüs bağlama bölgesi mevcut olmalıdır. Bu tür dizileri aramak için, ClustalW (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_server.html) kullanılarak çoklu hizalama yapıldı. Analiz için PTB1 ile susturulmuş hücrelerde etkilenen PPT dizilerini taşıyan 41 transkript ve PTB2 ile susturulmuş hücrelerde etkilenen 98 transkript dizisi seçildi. Bu bağlanma bölgeleri 3'x02032 UTR'de kolayca saptandığından, veri setini oluşturmak için sadece 3'x02032 UTR dizileri kullanıldı. Dizi hizalaması Ek Tablo S-5'te sunulmaktadır. Vurgulanan diziler, PPT'ye gömülü bir veya iki PTB bağlanma bölgesi içerir.

PTB1 ve PTB2 için gereklidir trans-C açısından zengin polipirimidin yolları taşıyan transkriptlerin eklenmesi

Yukarıda belirtildiği gibi, AATP11 gibi transkriptler, mRNA stabilitesine atfedilebilecek etkilerin ötesinde aşağı regüle edildi, bu da PTB'nin ekleme düzeyinde de çalışabileceğini düşündürdü. Bu gözlem bizi, bir sonucu olarak aşağı regüle edilen genlerin 5′ UTR'sini incelemeye yöneltti. PTB1 veya PTB2 susturma. Konsensüs PPT'si olmayan, çoğunlukla U'lara sahip, ancak C açısından zengin PTB sitelerine sahip transkriptler belirledik. Altı transkript seçildi ve bunların AG ek yeri, ilk AUG ve SL sens primerine yakın yerleştirilmiş bir anti-sens primeri ile RT-PCR kullanılarak spesifik mRNA'nın amplifiye edilmesiyle belirlendi. Altı genin AG ekleme bölgesinin yukarı akışındaki dizi, Şekil 11A'da gösterilmektedir, varsayılan PPT kutu içine alınmış ve italik yazılmıştır. Dizilerin incelenmesi, bu transkriptlerde, AG ile PPT arasındaki mesafenin, çoğu durumda, daha önce gözlemlenen 25 nt ortalamasından daha uzun olan 10 nükleotid (nt) olduğunu göstermektedir (Benz ve diğerleri, 2005). U/C oranı, transkriptlerin çoğunda bulunan 2 ile karşılaştırıldığında 1.52'dir (Benz ve ark. 2005). Ek olarak, PPT alanlarının her birine gömülü bir PTB bağlanma sahası bulundu. olup olmadığını incelemek için trans- bu transkriptlerin eklenmesi aşağıdakilerden etkilenir: PTB susturma, olgun ve ön-mRNA seviyeleri, RT-PCR ile PTB susturma üzerine belirlendi. U2AF65, PPT bölgelerine bağlandığından (Zamore ve diğerleri, 1992), olup olmadığını belirlemek ilgi çekiciydi. trans- bu PPT C açısından zengin transkriptlerin eklenmesi de U2AF65'in varlığına bağlıdır. NS brucei U2AF65 yakın zamanda tanımlanmıştır ve memeli homologundan daha büyüktür. SF1 ile etkileşime girer ancak U2AF35 ile etkileşime girmez ve sürecin ilk adımını etkiler. trans-splicing reaksiyonu (Vazquez ve ark. 2009). Bu amaçla, trans- altı transkriptin birleştirilmesi şurada incelendi: PTB1 sessiz hücreler, PTB2 susturulmuş hücreler ve U2AF65 sessiz hücreler Sonuçlar (Şekil 11B), transkriptlerin beşinde, trans- ekleme bozuldu PTB1 susturulmuş hücreler veya PTB2 susturulmuş hücreler, bu da trans- bu transkriptlerin eklenmesi, PTB1 veya PTB2'nin varlığına bağlıdır. Spesifikliği ve reaksiyonlarda kullanılan RNA miktarını kontrol etmek için, bu transkriptin seviyesi PTB1 veya PTB2 susturma üzerine değişmediğinden kontrol olarak tubulin mRNA kullandık. İçin U2AF65, U2AF65'i etkileyen genel bir ekleme faktörü olduğundan, normalizasyon için 7SL RNA seviyesi kullanıldı. trans- tüm genlerin eklenmesi. Bu nedenle Şekil 11'deki sonuçlar, PTB proteinlerinin U2AF65'in yerine değil, ona ek olarak işlev gördüğünü ileri sürer, çünkü trans-aynı altı transkriptin eklenmesi, uygun şekilde işlevsel U2AF65'in varlığını gerektiriyordu. trans-birleştirme.

olan genlerin analizi trans-Splicing, PTB proteinleri tarafından düzenlenir. (A) AG ek yerinin yukarısındaki sekans belirtilir ve AG sekansları kalın ve altı çizili, PPT sekansı italik ve kutulu ve PPT sekansları içindeki varsayılan PTB bağlanma yerleri kalın yazılmıştır. PTB1 veya PTB2 tarafından erişim numarası ve düzenleme belirtilir. (B) altında pre-mRNA ve olgun mRNA seviyesini belirlemek için RT-PCR PTB1, PTB2, ve U2AF65 susturma. cDNA, uyarılmamış hücrelerden veya 3 günlük susturma işleminden sonra hücrelerden hazırlandı. cDNA miktarının kalibrasyonu tubulin geni kullanılarak yapıldı. RT-PCR, Malzemeler ve Yöntemler bölümünde açıklandığı gibi yapıldı. Pre-mRNA ve olgun RNA'yı büyütmek için kullanılan primerler, Ek Tablo S-1'de listelenmiştir. PCR ürünleri %1 agaroz jeller üzerinde ayrıldı ve etidyum bromür ile lekelendi. Genlerin erişim numaraları verilmiştir. Her numunedeki cDNA miktarı için bir kontrol olarak, RNA için tubulin miktarı, PTB1 ve PTB2 susturulmuş hücreler ve U2AF65 susturulmuş hücrelerden RNA'daki 7SL RNA miktarı.

Memelilerde PTB bir ekleme baskılayıcı olduğundan, C açısından zengin bir PPT bölgesi taşıyan genler için yukarı regüle edilmiş genlerin veri setini aradık. Böyle bir transkript (listedeki 6 numara, Tb11.01.3580) tespit edildi ve gerçekten de, PTB1 geliştirdi trans- ekleme, PTB1'in bir ekleme baskılayıcı veya aktivatör olarak hizmet edebileceğini düşündürür. PPT'lerinde PTB bağlanma bölgelerine sahip olan ve susturma sırasında seviyeleri yukarı doğru düzenlenen transkriptler arasında bu tür daha birçok transkript bulunabilir.

Tanımlanması AATP11 PTB1 bağlanma bölgeleri in vivo ve in vitro

PTB'nin Şekil 11A'da belirtilen varsayılan bağlanma bölgelerine bağlandığını doğrulamak için, AATP11 Daha fazla analiz için substrat kullanıldı. Son çalışmalar, bu genin parazitin prosiklik aşamasında yüksek oranda eksprese edildiğini ve genin 3'lü UTR'sinde bulunan sekanslar tarafından dikte edilen mRNA stabilitesi ile düzenlendiğini göstermektedir (Robles ve Clayton 2008). sırası AATP11 ve AG bağlantı yerine göre PPT'nin konumu Şekil 12A'da sunulmaktadır (EST <"tip":"entrez-nükleotid","attrs":<"metin":"AF009707","term_id":"2735809" >> AF009707). incelemek için bir RNase koruma testi yapıldı. trans-birleştirme kusurları AATP11 içinde PTB1 sessiz hücreler Sonuçlar (Şekil 12B, panel c), öncünün birikimini ve olgunda azalmayı gösterir. AATP11 PTB1 susturmasının bir sonucu olarak.

in vivo ve in vitro analizleri AATP11, eklenmesi PTB1 tarafından düzenlenen bir gen. (A) şematik gösterimi AATP11 Transcript. AG ek yeri ve PPT'nin altı çizilidir. PPT'ye eklenen baz ikameleri oklarla gösterilmiştir. (B) RNaz koruması AATP11 Transcript. Prematüre ve matürlerin RNase koruması için kullanılan probların şematik gösterimi AATP11 transkriptler. (Panel a) Olgun ve öncü korumalı fragmanların nükleotidlerinde beklenen boyutta vahşi tip transkripti korumak için kullanılan prob belirtilir. (Panel B) Korumak için kullanılan sondanın şematik gösterimi AATP11 5′ düzenleyici birim, lusiferaz genine kaynaşmıştır. Olgun ve korunmuş parçaların boyutları belirtilmiştir. (Panel C) Korunan parçalar AATP11 vahşi tip transkript. RNA, Malzemeler ve Yöntemler bölümünde açıklandığı gibi RNaz korumasına tabi tutuldu ve ürünler, %6'lık bir akrilamid M üre jeli üzerinde ayrıldı. PTB1'in 3 günlük indüksiyonundan (+Tet) sonra indüklenmemiş hücrelerden (−Tet) ve hücrelerden korunan fragmanlar sunulur. P, prob C'yi, kontrolü (RNase sindirim karışımına RNA eklenmemiştir) ve M, işaretçiyi (uç etiketli pBR322 MspI özetini) gösterir. Öncül ve olgun AATP11'in pozisyonları belirtilmiştir. (Panel NS) AATP11-lusiferaz kaynaşmış transkriptin RNaz koruması. RNA, AATP11 5′ düzenleyici birimden (pNS21b) gelen lusiferaz genini eksprese eden transgenik parazitlerden hazırlandı. İfade, 3 günlük susturmanın ardından PTB1 hücrelerinde izlendi. Korunan parçalar %6 akrilamid M üre jeli üzerinde ayrıldı. Korunan fragmanın daha uzun bir pozu sunulur ve oklarla gösterilir. P, prob C'yi, kontrolü gösterir (RNase koruma testine RNA eklenmemiştir). (Panel e) Bir PPT mutasyonu taşıyan AATP11-lusiferaz kaynaşmış transkript üzerinde RNaz koruması. aynı NS ancak RNA, PPT mutasyonunu taşıyan hücrelerden hazırlandı. (C) Çapraz sevilen proteinler AATP11 transkript ve PPT sitesinde mutasyonları taşıyan transkript. (Doğru panel) Çapraz bağlama, artan miktarlarda etiketlenmemiş, radyoaktif olmayan, rakip AATP-11 transkripti varlığında tam hücre özleri kullanılarak Malzemeler ve Yöntemler'de açıklandığı gibi gerçekleştirildi. (şeritler 14) Artan miktarlarda etiketlenmemiş vahşi tip AATP-11 (sırasıyla 0, 50, 100, 200 ng) (şerit 58) artan miktarlarda PPT mutasyonunu taşıyan etiketlenmemiş, radyoaktif olmayan AATP-11 (sırasıyla 0, 50, 100, 200 ng) (şerit 9) rekombinant PTB1 ile çapraz bağlama. (Sol) Batı analizi. Çapraz bağlı malzeme, anti-PTB1 antikorları ile Western analizine tabi tutuldu. (Lane 1) Rekombinant protein (50 ng) kullanarak çapraz bağlama (şerit 2) tam hücre özü kullanarak çapraz bağlama. Protein markörünün boyutu belirtilir.

Ardından, 5′ yan dizileri AATP11 için gerekli sinyalleri taşıyan AG ek yerinin ek bir 260 nt yukarı akışıyla pNS21b vektörüne (64 nt 5'x02032 UTR) klonlandı. trans- genin eklenmesi. Bu nedenle vektör, ekspresyonu, hücrenin 5′ yan dizilerine bağlı olan bir lusiferaz geni içerir. AATP11 gen (Şekil 12B, panel b). Transkript, güçlü EP promotöründen eksprese edilir (Siegel ve diğerleri, 2005) ve 3'lü UTR dizileri, EP geninden türetilir. Birleştirilmiş transkript, AATP11 geninin otantik 3'ü 02032 UTR'sinden yoksun olduğundan, bu çalışmada gözlemlenen ifade üzerindeki etki, yalnızca PTB'nin AATP11 PPT sitesi.

AG ek yerinin 10 nt akış yukarısında mevcut olan ve PTB bağlama bölgesini taşıyan dizinin gerçekten de ekleme düzenlemesini yöneten bölge olduğunu doğrulamak için. AATP11 PTB1 ile bu sitedeki C'ler U'lara dönüştürülmüş ve böylece PTB bağlanma bölgeleri yok edilmiştir. Yapının yapısı Şekil 12B, panel b'de gösterilmektedir ve PPT sahasında tanıtılan mutasyonların yeri Şekil 12A'da gösterilmektedir. Muhabir geni taşıyan transgenik parazitler ve ayrıca susturmak için gövde ilmek yapısı PTB1 oluşturuldu. işlenmesi AATP11 lusiferaz ile kaynaşmış transkript, RNaz koruması ile incelendi. Şekil 12B, d'de sunulan sonuçlar, vahşi tip gen gibi, AATP11-lusiferaz eklemesi, susturulmuş hücrelerde olgun RNA'da bir azalma ve öncü birikimi gözlendiğinden, PTB1'e bağlıydı. Bununla birlikte, mutasyona uğramış PPT yolunu taşıyan hücrelerde PTB1 düzenlemesi kaybolmuştur. AATP11 transkript, ekleme için PTB1'e herhangi bir bağımlılık göstermedi (Şekil 12B, e). Aslında, mRNA seviyeleri azalmadı, biraz yükseldi. Bu veriler, PTB bağlanma bölgesini taşıyan ve C'ler açısından zengin PPT'nin gerçekten de PTB1 düzenlemesini sağlayan bağlanma bölgeleri olduğunu göstermektedir. AATP11.

PTB'nin doğrudan bağlanmasını incelemek için AATP11 substrat, pre-mRNA ya rekombinant PTB1 ya da tam hücre özü ile inkübe edildi ve UV çapraz bağlamaya maruz bırakıldı. RNaz sindiriminden sonra, radyoaktivite yalnızca etiketli RNA'ya bağlanan proteinlerle ilişkili kalır. Böyle bir deneyin sonuçları Şekil 12C'de sunulmaktadır. çapraz bağlı hale gelen proteinlerden biri AATP11 PTB1'dir, rekombinant PTB1 ile aynı moleküler ağırlığa sahip göç eden bir protein, pre-mRNA tam hücre özütünde bulunan proteinlere çapraz bağlandığında tanımlandı. Tam hücre özütünde PTB1 bandının tanımlanması, Western analizi ile doğrulandı (Şekil 12C, sol panel). Ek olarak, bu proteine ​​çapraz bağlanma (bir okla işaretlenmiştir) önceden etiketlenmediğinde azalmıştır.AATP11 reaksiyona eklendi (etiketlenmemiş RNA'nın 200 molar fazlasının eklenmesiyle %24 bağlanmaya azalma), ancak etiketlenmemiş mutasyona uğradığında değil AATP11PTB sitelerinden yoksun olan, rekabet için kullanıldı (etiketlenmemiş RNA'nın 200 molar fazlasının eklenmesiyle %85 bağlanmaya azalma) (Şekil 12C). Bu sonuçlar açıkça PTB'nin doğrudan bağlandığını göstermektedir. AATP11 önerilen PTB1 bağlanma yerinde substrat. Dikkat edin, bu tür bir bağlayıcı AATP11 ayrıca, PTB substratlarını immüno-çökeltmek için anti-PTB1 antikorları kullanıldığında da saptandı (Şekil 8A).

PTB1 için gereklidir, ancak PTB2 değil cis-birleştirme

PTB'nin etkilediği gösterildiğinden beri cis-memelilerde ekleme ve sadece 3'x02032 ek yerinin yukarı akışındaki PPT'ye değil, aynı zamanda 5'x02032 ek yeri bölgesine de bağlandığı gösterildi, PTB'nin aynı zamanda aşağıdakiler için de gerekli olup olmadığını inceledik. cis-birleştirme. Bu amaçla, maruz kaldığı bilinen iki substrat cis-splays incelendi. Şekil 13'teki sonuçlar, RT-PCR ile (RNA miktarını kontrol etmek için tubulin kullanarak) hem poli A polimerazın (PEİ) ve ATP'ye bağımlı DEAD/H RNA helikaz (ADRH) susturulmuş hücrelerde etkilenmiştir, çünkü her iki gende de, öncünün net birikimi ile olgun RNA'nın azalması gözlemlenmiştir. Bu genlerin PPT'sinin incelenmesi, bölgelerinin geleneksel olduğunu göstermektedir. Bir PTB bağlanma bölgesinin varlığı, ya 5′ ek yeri yakınında gözlendi. PEİveya intronda birkaç pozisyonda, ADRH (bkz. Ek Tablo S-6). ilginç bir şekilde etkisi yok cis- PTB2 susturulmuş hücrelerde ekleme gözlemlendi (Şekil 13).

cis- poli A polimerazın eklenmesi (PEİ) ve ATP'ye bağımlı DEAD/H RNA helikazları (ADRH) PTB1 tarafından düzenlenir, ancak PTB2 tarafından düzenlenmez. RT-PCR ile tespit edilen PAP ve ADRH öncüsü ve olgun mRNA seviyeleri. cDNA, Malzemeler ve Yöntemler'de tarif edildiği gibi hazırlandı. cDNA, Ek Tablo S-1'de listelenen primerlerle PCR analizi için kullanıldı. Reaksiyonda kullanılan primerlerin ve beklenen PCR ürünlerinin şematik gösterimi aşağıdaki resimde gösterilmiştir. sol. PCR reaksiyonları, %1'lik bir agaroz jeli üzerinde analiz edildi. (Sol) PTB1 susturulmuş hücrelerin analizi. İndüklenmemiş hücrelerden (−Tet) cDNA ve indüksiyondan 3 gün sonra (+Tet) PTB1 susturulmuş hücrelerden cDNA. (Doğru) PTB2 susturulmuş hücrelerin analizi. İndüklenmemiş hücrelerden (−Tet) cDNA ve indüksiyondan 3 gün sonra PTB2 susturulmuş hücrelerden cDNA (+Tet). Her numunedeki cDNA miktarını kontrol etmek için tubulin transkript seviyesi kullanıldı.


Bozulma

Aynı hücre içindeki farklı mRNA'ların farklı ömürleri (kararlılıkları) vardır. Bakteri hücrelerinde, bireysel mRNA'lar saniyelerden bir saatten fazlaya kadar hayatta kalabilir. Bununla birlikte, yaşam süresi ortalama 1 ile 3 dakika arasındadır ve bakteriyel mRNA'yı ökaryotik mRNA'dan çok daha az stabil hale getirir. ⎤] Memeli hücrelerinde, mRNA ömürleri birkaç dakika ile günler arasında değişir. ⎥] Bir mRNA'nın kararlılığı ne kadar yüksek olursa, o mRNA'dan o kadar fazla protein üretilebilir. MRNA'nın sınırlı ömrü, bir hücrenin değişen ihtiyaçlarına yanıt olarak protein sentezini hızla değiştirmesini sağlar. Bir mRNA'nın yıkımına yol açan, bazıları aşağıda açıklanan birçok mekanizma vardır.

Prokaryotik mRNA bozulması

Genel olarak prokaryotlarda mRNA'nın ömrü ökaryotlardan çok daha kısadır. Prokaryotlar, endonükleazlar, 3' eksonükleazlar ve 5' eksonükleazlar dahil olmak üzere ribonükleazların bir kombinasyonunu kullanarak mesajları bozar. Bazı durumlarda, onlarca ila yüzlerce nükleotit uzunluğundaki küçük RNA molekülleri (sRNA), tamamlayıcı dizilerle baz eşleşmesi yaparak ve RNase III tarafından ribonükleaz bölünmesini kolaylaştırarak spesifik mRNA'ların bozunmasını uyarabilir. Yakın zamanda bakterilerin de 5' ucunda bir trifosfattan oluşan bir çeşit 5' başlığı olduğu gösterilmiştir. ⎦] İki fosfatın çıkarılması, 5' monofosfat bırakır ve mesajın, 5' ila 3' arasında parçalanan eksonükleaz RNase J tarafından yok edilmesine neden olur.

Ökaryotik mRNA cirosu

Ökaryotik hücrelerin içinde, çeviri süreçleri ile mRNA bozunması arasında bir denge vardır.Aktif olarak çevrilmekte olan mesajlar, ribozomlar, ökaryotik başlatma faktörleri eIF-4E ve eIF-4G ve poli(A) bağlayıcı protein tarafından bağlanır. eIF-4E ve eIF-4G, kapak açma enzimini (DCP2) bloke eder ve poli(A) bağlayıcı protein, mesajın uçlarını koruyarak eksozom kompleksini bloke eder. Translasyon ve bozulma arasındaki denge, P-cisimleri ⎧] olarak bilinen sitoplazmik yapıların boyutuna ve bolluğuna yansır. RNA üzerindeki cis düzenleyici diziler ve trans-etkili RNA bağlayıcı proteinler. Poli(A) kuyruğunun çıkarılmasının, mesajın dairesel yapısını bozduğu ve başlık bağlama kompleksinin dengesini bozduğu düşünülmektedir. Mesaj daha sonra eksozom kompleksi veya kapak çıkarma kompleksi tarafından bozulmaya tabi tutulur. Bu şekilde, aktif mesajlar bozulmadan kalırken, çevirisel olarak etkin olmayan mesajlar hızla yok edilebilir. Çevirinin durduğu ve mesajın bozunma komplekslerine iletildiği mekanizma ayrıntılı olarak anlaşılmamıştır.

AU açısından zengin element bozunması

Bazı memeli mRNA'larında AU açısından zengin elementlerin varlığı, bu dizileri bağlayan ve poli(A) kuyruğunun çıkarılmasını uyaran hücresel proteinlerin etkisiyle bu transkriptleri kararsızlaştırma eğilimindedir. Poli(A) kuyruğunun kaybının, hem eksozom kompleksi ⎨] hem de kapak açma kompleksi tarafından saldırıyı kolaylaştırarak mRNA bozulmasını desteklediği düşünülmektedir. ⎩] AU bakımından zengin elementler yoluyla hızlı mRNA bozunması, tümör nekroz faktörü (TNF) ve granülosit-makrofaj koloni uyarıcı faktör (GM-CSF) gibi güçlü sitokinlerin aşırı üretimini önlemek için kritik bir mekanizmadır. ⎪] AU bakımından zengin elementler ayrıca c-Jun ve c-Fos gibi proto-onkojenik transkripsiyon faktörlerinin biyosentezini de düzenler. ⎫]

Anlamsız aracılı bozunma

Ökaryotik mesajlar, mesajda erken durdurma kodonlarının (saçma kodonlar) varlığını kontrol eden anlamsız aracılı bozulma (NMD) tarafından gözetime tabidir. Bunlar, tamamlanmamış ekleme, adaptif bağışıklık sisteminde V(D)J rekombinasyonu, DNA'daki mutasyonlar, transkripsiyon hataları, çerçeve kaymasına neden olan ribozom tarafından sızdıran tarama ve diğer nedenlerle ortaya çıkabilir. Erken bir durdurma kodonunun saptanması, 5' kapak açma, 3' poli(A) kuyruğu çıkarma veya endonükleolitik bölünme yoluyla mRNA bozulmasını tetikler. ⎬]

Küçük enterferans yapan RNA (siRNA)

Metazoanlarda, Dicer tarafından işlenen küçük enterferans yapan RNA'lar (siRNA'lar), RNA kaynaklı susturma kompleksi veya RISC olarak bilinen bir komplekse dahil edilir. Bu kompleks, siRNA'nın bağlandığı mükemmel şekilde tamamlayıcı mesajları parçalayan bir endonükleaz içerir. Elde edilen mRNA fragmanları daha sonra eksonükleazlar tarafından yok edilir. siRNA, hücre kültüründeki genlerin işlevini bloke etmek için laboratuvarlarda yaygın olarak kullanılır. Çift sarmallı RNA virüslerine karşı bir savunma olarak doğuştan gelen bağışıklık sisteminin bir parçası olduğu düşünülmektedir. ⎭]

MikroRNA (miRNA)

MikroRNA'lar (miRNA'lar), tipik olarak metazoan haberci RNA'larındaki dizilere kısmen tamamlayıcı olan küçük RNA'lardır. ⎮] Bir miRNA'nın bir mesaja bağlanması, o mesajın çevirisini baskılayabilir ve poli(A) kuyruğunun çıkarılmasını hızlandırabilir, böylece mRNA bozulmasını hızlandırabilir. miRNA'ların etki mekanizması aktif araştırma konusudur. ⎯]

Diğer bozunma mekanizmaları

Diğerlerinin yanı sıra, Piwi etkileşimli RNA (piRNA) tarafından kesintisiz bozulma ve susturma dahil olmak üzere, mesajların bozulmasının başka yolları da vardır.


Malzemeler ve yöntemler

Tavuk beyni ve fibroblast ekstraktlarının hazırlanması

12 günlük civciv embriyolarından beyin sitoplazmik özütü hazırlandı. Bütün beyinler çıkarıldı ve üç kez tampon A (20 mM Tris Cl, 3 mM MgCl) ile yıkandı.2, 40 mM KCl ve 1 mM DTT, 0.7 ug/ml leupeptin, 1 ug/ml aprotinin, 0.7 ug/ml pepstantin ve 1 mM PMSF). Islak doku gramı başına 1 ml tampon A ilave edildi ve karışım, bir Teflon cam homojenleştirici içinde homojenleştirildi. Homojenatlar, 5.000'de 10 dakika santrifüj edildi. Gve süpernatan, bir Beckman SW-40.1 rotorunda 28,000 rpm'de 2 saat boyunca santrifüjlendi. Yüksek hızlı süpernatan ya hemen kullanıldı ya da -70°C'de alikuotlarda saklandı. Beyin ekstraktının protein konsantrasyonu ∼10–20 μg/μl idi. CEF özü hazırlamak için, 11 günlük civciv embriyolarının göğüs kas dokusundan fibroblastlar izole edildi. Hücreler -%95 konfluansa büyütüldü (Kislauskis ve diğerleri, 1994) ve daha sonra kazındı ve soğuk tampon A'da yıkandı ve santrifüjleme ile topaklandı (Ross ve diğerleri, 1997). Hücreler, tampon A içinde yeniden süspanse edildi ve bir Dounce homojenleştirici içinde homojenleştirildi. Homojenatlar yukarıda tarif edildiği gibi santrifüjlendi. Hazırlanan ekstraktın protein konsantrasyonu 5-10 µg/µl idi.

Nöronal kültürler

Embriyonik civciv ön beyin nöronlarının birincil kültürleri, daha önce tarif edildiği gibi üretildi (Zhang ve diğerleri, 1999). Kısaca, ön beyinler 8 günlük civciv embriyolarından diseke edildi, tripsinize edildi, ayrıştırıldı ve MEM'de poli-l-lizin- (0.2 mg/ml, 16 saat) ve laminin- (0.02 mg/ml, 12 dakika) kaplı lameller üzerine kaplandı. 2 saat boyunca %10 FBS ile. Hücreler, N'de tek bir civciv astrosit tabakasına ters çevrildi.2-serum (%0.2 FBS) ile şartlandırılmış ortam ve %5 CO2 içinde 37°C'de 4 gün kültürlendi2.

In vitro RNA transkripsiyonu

pCZIP, civciv β-aktin mRNA'nın 54 nükleotid posta kodunun Hind III ve Ava I bölgelerinde bir pSP64-Poly(A) vektörüne (Promega) eklenmesiyle oluşturulmuştur. pCZIPm plazmitini oluşturmak için, aşağıdaki çift tamamlayıcı oligo sentezlendi, tavlandı ve pSP64 Poly(A) vektörünün Hind III ve Ava I bölgeleri arasına yerleştirildi: Sense: 5′ AGCTTACCGGACT-GTTACCATGTGTGTGTGCTGTGATGAAACAAAACCCATAAATGC 3′ ve antisense: 5′ CCGTTGCATGCATTTAG ′.

Jel mobilite kaydırma deneyleri için, [32P]-etiketli RNA, Ava I lineerleştirilmiş pCZIP DNA'dan in vitro transkripsiyona yönelik SP6 RNA polimeraz tarafından üretildi. Kopyalanan RNA, %6 ile jel ile saflaştırıldı. RNA afinite saflaştırması için, poliadenile transkriptler, EcoRI ile doğrusallaştırılmış pCZIP yapılarından SP6 polimeraz (MEGAScript kiti Ambion) ile in vitro sentezlendi. [32P]-CTP'nin eser miktarları, kopyalanan RNA'nın saptanmasına ve nicelenmesine olanak sağlamak için eklenmiştir. Kopyalanan RNA, 54 nt pCZIP RNA ve 30 nt'lik bir poli(A) kuyruğu içeriyordu.

Jel mobilite kaydırma testi ve UV çapraz bağlama

Kısaca, [32 P] etiketli RNA probunun 105 CPM'si, 20 mM Hepes, pH 7.4, 50 mM KCl içeren 20 ul'lik bir bağlama solüsyonunda 20 dakika boyunca 5 ul beyin veya fibroblast protein özütü ile oda sıcaklığında inkübe edildi. , 3 mM MgCl2, 2 mM DTT ve %5 gliserol. Bağlanmamış RNA'lar, 1 U RNase T ile 10 dakikalık bir inkübasyonla bozuldu1ve spesifik olmayan RNA-protein etkileşimleri, 10 dakika boyunca 5 mg/ml heparin ile inkübasyon yoluyla en aza indirildi. Oluşan RNA-protein kompleksleri, %4 doğal jel içinde ayrıldı ve otoradyografi ile görselleştirildi. RNA-protein etkileşimlerinin özgüllüğünü belirlemek için, protein özütünün etiketlenmemiş RNA rakipleriyle önceden inkübe edilmesiyle rekabet deneyleri yapıldı.

RNA-protein komplekslerinin UV çapraz bağlanması, reaksiyonların bir UV Odasında (GS gen bağlayıcı Bio-Rad Laboratories) 10 dakika boyunca 254-nm, 8-W UV ampulleri ile buz üzerinde ışınlanması ve %4 doğal jel ile çözülmesiyle gerçekleştirildi. Otoradyografi ile tespit edilen UV çapraz bağlı RNA-protein kompleksleri jelden kesildi, SDS yükleme tamponu ile karıştırıldı ve oda sıcaklığında 30 dakika boyunca 10 U RNase T1 ile inkübe edildi. Jel dilimleri, %10'luk bir SDS-poliakrilamid jele yüklendi ve RNA-protein komplekslerini ayırt etmek için elektroforeze tabi tutuldu.

RNA'ya bağlanan proteinlerin afinite saflaştırması

2 ml poli(U) agaroz boncukları (tip 6 Amersham Pharmacia Biotech), RNA bağlama tamponu (25 mM Tris HC1, pH 7.4, 100 mM KCl) içinde süspanse edildi ve 10 ml'lik bir kolona paketlendi. Yaklaşık 1 mg in vitro sentezlenmiş poli(A) zipcode RNA kolona eklendi ve dört kez döngüye alındı. Poli(U) agaroz boncuklarına bağlanan RNA'nın etkinliği, RNA preparasyonunda mevcut olan [32P] etiketli RNA miktarı ölçülerek izlendi. Bağlandıktan sonra boncuklar ekstrakt tamponu ile dengelendi, 40 ml beyin protein ekstraktları veya 50 U/ml RNasin (Promega) içeren 20 ml fibroblast ekstraktları ile karıştırıldı ve 1 saat boyunca oda sıcaklığında hafifçe çalkalanarak inkübe edildi. Spesifik olmayan protein bağlanmasını azaltmak için, maya tRNA'sı ve heparin, sırasıyla 50 μg/ml'ye ve 5 mg/ml'ye bağlanma tamponuna ilave edildi. Boncuklar daha sonra 2 dakika 1000°C'de santrifüj edildi. G, bağlama tamponunda yeniden süspanse edildi ve 10 ml'lik bir sütuna yeniden paketlendi. Kolon, 5 x 20 ml bağlama tamponu içinde aşağıdaki şekilde kapsamlı bir şekilde yıkandı: (1) bağlama tamponu (2) bağlama tamponu + 40 µg/ml maya RNA (3) bağlama tamponu + 5 mg/ml heparin (4) bağlama tamponu + Yalnızca %0,1 Triton X-100 ve (5) bağlama tamponu. RNA afinite kolonunda tutulan proteinler, 0.5, 1 ve 2 M KCl içeren 20 mM Hepes tamponu, pH 7.4 ile adım adım ayrıştırıldı. Elute edilen proteinler, SDS-PAGE ve bant kaydırma deneyi ile analiz edildi.

Sıçan anti-ZBP2 antikorlarının üretimi

Posta kodu afinite sütunundan gelen 2-M KCl elüsyon fraksiyonu, centricon-30 filtresi ile konsantre edildi ve %10 SDS-PAGE içinde eletroforlandı. Coomassie mavisi ile boyandıktan sonra, beklenen protein bantları jelden kesildi, ezildi, adjuvan ile karıştırıldı ve antikor üretimi için sıçanlara (Covance, Inc.) enjekte edildi. Antiserumun titresi, immünoblot ile test edildi.

Immünoblotlama

Proteinlerin alikuotları %10 SDS-PAGE içinde çözüldü ve bir yarı kuru transfer kurutma kağıdı (Bio-Rad Laboratories) ile Zeta zarlarına aktarıldı. Membranlar, 4°C'de %5 yağsız süt içeren PBS ile gece boyunca lekelendi ve ardından oda sıcaklığında 2 saat boyunca %1 BSA içeren PBS içinde ZBP2'ye (1:2.000) karşı antiserum ile inkübe edildi. PBS/%0,3 Tween-20 ile üç kez yıkandıktan sonra, membranlar yaban turpu peroksidaz konjuge keçi anti-sıçan antikorları (1:8,000) ile inkübe edildi, ECL sistemi (Amersham Pharmacia Biotech) veya DAB/H ile ZBP2 tespit edildi.2Ö2.

İmmünopresipitasyon ve β-aktin mRNA tespiti

ZBP2'ye karşı 10 µg saflaştırılmış antikorlar veya 5 µl antiserum, 100 µl beyin proteini özü ile 4°C'de hafif çalkalanarak 1 saat inkübe edildi. Karışıma 30 µl protein G-bağlı agaroz boncukları (Pierce Chemical Co.) ilave edildi ve 1 saat daha 4°C'de inkübe edildi. 1500'de 5 dakika santrifüj edildikten sonra G, süpernatan, immünoblotlama ve RNA bant kaydırma deneyleri için alındı. ZBP2'nin analizi için, topak haline getirilmiş agaroz taneleri, PBS ile kapsamlı bir şekilde yıkandı ve tanelere bağlanan proteinler, 100 ul ImmunoPure IgG Elüsyon Tamponu (Pierce Chemical Co.) ile ayrıştırıldı. β-aktin mRNA'yı saptamak için, peletlenmiş agaroz boncukları üç kez DEPC-PBS ile yıkandı, 100 ul DEPC su içinde yeniden süspanse edildi ve 10 dakika kaynatıldı. Toplam RNA, süpernatandan TRIzol RNA izolasyon reaktifi (GIBCO BRL) kullanılarak ekstre edildi. β-aktin mRNA için RT-PCR, ReadyToGo RT-PCR-boncukları (Amersham Pharmacia Biotech) kullanılarak şablon olarak 1 ul RNA ile 20 döngü için gerçekleştirildi. Amplifikasyon için aşağıdaki primerler kullanıldı: 5' CTGACACCTTCACCATTCCAG 3' ve 5' ATTGCTGACAGGATGCAGAAG 3'. Beklenen PCR ürünü, 1021–1419 pozisyonlarında 3′ UTR'de β-aktin mRNA'nın 398-bp'lik bir DNA fragmanıdır.

ZBP2 cDNA'nın izolasyonu ve klonlanması

İki primer, zbp2-1 ve zbp2-2, iki peptit dizisine (sırasıyla ZBP2 amino asitleri 621-627 ve 685-709) ve insan KSRP cDNA dizisine (zbp2-1 GCTTGGGAGGAGTACTACAA, zbp2-2 AGGTGACCTGGTAGG) göre tasarlanmış ve sentezlenmiştir. ): 200 bp'lik bir DNA parçası, bir tavuk embriyo beyin kütüphanesinden (CLONTECH Laboratories, Inc.) amplifiye edildi ve dizileme ile doğrulandı. Bu fragman, tavuk embriyo beyin kütüphanesini taramak için kullanıldı. Kütüphane taramasından iki cDNA klonu izole edildi. Dizi analizinden sonra, her iki klonun da bir 500-bp COOH-terminal kodlama dizisi ve ardından 150 bp 3' UTR içerdiği açıktı. NH elde etmek için 5′ RACE PCR uygulandı2ZBP2'nin (CLONTECH Laboratories, Inc.) terminal fragmanı 5′ RACE deneyinde RACE 4 primerleri kullanıldı (RACE6–1: CACGCGGCGTTGGGGTCGGCTGC, RACE7: TTATAGGCGGCCCA-CGCGGCGTTGG, RACEF1: GAACGCGTCCTCGGATCGGATCC, RACETTTT). RACE tarafından amplifiye edilen DNA fragmanlarının dizileri, otomatik DNA dizi analizleri ile belirlendi. Tam uzunluktaki gen, PCR ile birleştirildi ve dizileme ile doğrulandı.

Yerinde hibridizasyon ve immünositokimya

In situ hibridizasyon, Kislauskis ve diğerleri tarafından tarif edildiği gibi fibroblastlar üzerinde gerçekleştirilmiştir. (1993) ve Zhang ve diğerleri tarafından tarif edildiği gibi nöronlar üzerinde. (1999). 9 günlük CEF'ler, %10 FCS ile takviye edilmiş MEM'de kültürlendi. 2 gün boyunca lameller üzerinde büyütüldükten sonra hücreler, 10 dakika boyunca PBS içinde %4 paraformaldehit içinde sabitlendi ve oda sıcaklığında 10 dakika daha %0.5 Triton X-100 ile geçirgenleştirildi. ZBP2'nin CEF'lerde dağılımı, sıçan antiserumunun ZBP2'ye (1:800) karşı inkübasyonu ve ardından Cy3 veya FITC konjuge tavşan anti-sıçan antikorları (1:500 Jackson ImmunoResearch Lab) ile görselleştirildi. Nöronlar, 2 veya 4 gün boyunca %2 cenin sığır serumu (FBS) ile N2 koşullandırılmış ortamda kültürlendi ve oda sıcaklığında 15 dakika boyunca PBS içinde %4 paraformaldehit içinde sabitlendi. %0.5 Triton X-100 ile geçirgenleştirmeden sonra hücreler, ZBP2'ye karşı sıçan antiserumu (1:750) ve ardından Cy3 etiketli tavşan anti-sıçan antikorları (1:750) ile inkübe edildi. Yerinde hibridizasyon ve immünokimya için hücreler ilk önce β-aktin mRNA'nın hibridizasyonu için işlendi, PBS ile yıkandı ve daha önce tarif edildiği gibi immüno-lekelendi (Zhang ve diğerleri, 1999). Hücreler, 60x Plan Apo 1.4NA objektifli bir Olympus Bx60 ile görüntülendi. Görüntüler, Espirit görüntüleme yazılımı tarafından çalıştırılan soğutmalı bir CCD kamera ile elde edildi.

GFP füzyon proteini yapıları

D. Black'den (Los Angeles'taki California Üniversitesi, Los Angeles, CA) bir hediye olan insan KSRP cDNA'sı (tavuk ZBP2'nin homologu), EcoRI ve Hind III'te pEGFP C1 vektörüne (CLONTECH Laboratories, Inc.) alt klonlandı Siteler. (pGFP-KSRP). Diğer tüm EGFP füzyon yapıları ya tam uzunlukta ya da kesilmiş tavuk ZBP2'dir. ZBP2 ve 4-KH alanlarına özgü 47-aa dizisini içeren 103-650 aa dizisini içeren merkezi alan parçası, PCR ile büyütüldü ve plazmit pGFP-CD'yi oluşturmak için EcoRI ve Xbal bölgelerinde pEGFP-C1 vektörüne klonlandı. ZBP2'nin 4-KH alanları, pGFP-KH yapısını üretmek için SalI ve XbaI bölgesindeki pEGFP-C1 vektörüne klonlandı. 47-aa benzersiz dizisi, PCR ile büyütüldü ve EcoRI Hind III'te (pGFP-IN bölgesi) pEGFPC1'e dahil edildi. 650 amino asitlerinden durdurma kodonuna kadar olan COOH-terminal alanı, EcoRI ve XhoI siteleri kullanılarak plazmit pBS-LS2'den (kütüphane taramasından izole edilmiştir) kesilmiştir ve pGFP-CT üreterek pEGFPC1 vektörüne klonlanmıştır. Tam uzunluktaki ZBP2, pGFP-FULL üretmek için EcoRI ve Hind III bölgelerinde pEGFPC2'ye (CLONTECH Laboratories, Inc.) klonlandı. 47-aa benzersiz dizisi, iki aşamalı birleştirme PCR ile tam uzunluktaki ZBP2'den silindi ve pGFP-A47'yi oluşturmak için EcoRI ve Hind III siteleri tarafından pEGFPC2 vektörüne klonlandı. Yukarıda bahsedilen tüm yapılar, DNA dizilimi ile doğrulandı.

Transfekte edilmiş hücrelerin transfeksiyonu ve görüntülenmesi

CEF'ler, üreticinin protokolüne göre Qiagen Effectene Reaktifi kullanılarak GFP-ZBP2 yapıları ile 4-5 saat boyunca transfekte edildi. Kültürlenmiş nöronlar, tarif edildiği gibi DOTAP ile transfekte edildi (Zhang ve diğerleri, 1999). FISH ile veya FISH olmadan GFP görüntüleme yapıldı (Zhang ve diğerleri, 1999). CEF'ler için, GFP ve β-aktin mRNA sinyalleri, 60x objektifli bir Olympus Bx60 mikroskobu kullanılarak floresan mikroskobu ile görselleştirildi, n.a. 1.4. β-aktin mRNA lokalizasyonu için lamel başına en az 50 transfekte edilmiş hücre sayıldı.

Nöronlarda ifade edilen EGFP/ZBP2 füzyonu, 60x Plan-Neofluar objektifi, faz optiği, 100 W cıva ark lambası ve HiQ bant geçiren filtreler (ChromaTech) ile donatılmış bir floresan mikroskobu (Nikon Eclipse ters mikroskobu) kullanılarak tanımlandı. Floresan görüntüler, IP Lab bilgisayar yazılımı tarafından çalıştırılan soğutmalı bir CCD kamera ile sabit bir maruz kalma süresinde (1 s) hemen elde edildi. Her aksonal dendritin çevresi (hücre gövdesinden ilk 30 um) faz görüntüsü kullanılarak izlendi. İlgili bölge aynı hücrede floresan görüntüsüne aktarıldı ve β-aktin mRNA'nın floresan yoğunluğu IP Lab yazılımı ile ölçüldü. Lamel üzerindeki transfekte edilmemiş hücreler içindeki ROI'nin floresan yoğunluğu normal kontrol olarak ölçülmüştür. Her grupta 20'den fazla hücre analiz edildi.


Haberci RNA (mRNA)

Messenger RNA (veya mRNA), transkripsiyonda ana role veya bir DNA planından bir protein yapımında ilk adıma sahiptir. MRNA, çekirdekte bulunan ve orada bulunan DNA'ya tamamlayıcı bir dizi oluşturmak için bir araya gelen nükleotidlerden oluşur. Bu mRNA zincirini bir araya getiren enzime RNA polimeraz denir. MRNA dizisindeki üç bitişik nitrojen bazına kodon denir ve bunların her biri daha sonra bir protein yapmak için diğer amino asitlerle doğru sırayla bağlanacak olan spesifik bir amino asidi kodlar.

mRNA, gen ekspresyonunun bir sonraki adımına geçmeden önce, bazı işlemlerden geçmelidir. Herhangi bir genetik bilgiyi kodlamayan birçok DNA bölgesi vardır. Bu kodlamayan bölgeler hala mRNA tarafından kopyalanır. Bu, mRNA'nın, işleyen bir proteine ​​kodlanmadan önce, intron adı verilen bu dizileri kesmesi gerektiği anlamına gelir. Amino asitleri kodlayan mRNA bölümlerine ekson denir. İntronlar enzimler tarafından kesilir ve sadece eksonlar kalır. Bu artık tek bir genetik bilgi dizisi, translasyon olarak adlandırılan gen ekspresyonunun ikinci bölümünü başlatmak için çekirdekten çıkıp sitoplazmaya geçebilir.


Gen ifadesi


Genomlardaki kodlama bilgisi, bir veya birkaç gene karşılık gelen artışlarla kopyalanır. Transkripsiyonun başlamasını, uzamasını ve sonlandırılmasını yöneten gen kodlayan ve düzenleyici (cis-etkili) DNA dizileri topluca bir transkripsiyon birimi olarak adlandırılır. Operon adı verilen prokaryotik transkripsiyon birimleri, genellikle fizyolojik olarak ilişkili proteinleri kodlayan birden fazla gen içerir (Şekil 15-2A). Operonlar, transkripsiyonun başlatılmasını ve sonlandırılmasını yöneten dizilerle çevrilidir.Şekil 15-2B, insan hemoglobin p-zincirini kodlayan basit bir ökaryotik transkripsiyon birimini göstermektedir. Bu bölgenin sadece küçük bir kısmı β-globin polipeptidini kodlasa da, bitişik düzenleyici diziler β-globinin uygun ekspresyonu için çok önemlidir. β-globin üretiminin azalmasına neden olan genetik kusurlara β-talasemi denir. Bu tür mutasyonlar, kararsız veya kesik bir polipeptit ile sonuçlanan kodlama bölgesinde veya yeni sentezlenmiş RNA'nın düşük transkripsiyon seviyelerine veya anormal işlenmesine yol açan bitişik kontrol bölgelerinde meydana gelebilir (bkz. Bölüm 16). Bu nedenle, transkripsiyon ünitesi, genin doğru seviyede kopyalanması için hepsinin işlevsel olması gereken bağlantılı bir dizi modül olarak düşünülebilir.


Ökaryotik ribozomal RNA, son 28S, 5.8S ve 18S RNA'ları vermek üzere bölünen ve modifiye edilen tek bir molekül olarak art arda tekrarlanan bir dizi genden sentezlenir (Şekil 15-3). Bunlar, 5S RNA ve yaklaşık 80 protein ile birlikte nükleolustaki ribozomlarda birleştirilir. Transfer RNA çekirdekte sentezlenir ve protein sentezine katılmadan önce amino asitlerle yüklendiği sitoplazmaya taşınır (bkz. Bölüm 17). snRNA'lar çekirdekte sentezlenir ve işlenir. Oradan, temel proteinleri elde ettikleri sitoplazmaya göç ederler ve daha sonra RNA işlemenin enzimatik reaksiyonlarında işlev gösterdikleri çekirdeğe geri dönerler (birleştirme için bkz. Bölüm 16). Belirli bir transkriptin takip ettiği postsentetik işleme yolu, kısmen, transkripti başlatmak ve uzatmak için kullanılan transkripsiyon makinesi ve yeni oluşan RNA'nın belirli özellikleri tarafından belirlenir.


(B, Yvonne Osheim'ın izniyle, Virginia Üniversitesi, Charlottesville.)


(B, PDB dosyası: 1I50. Referans: Cramer P, Bushnell DA, Kornberg RD: Transkripsiyonun yapısal temeli: 2.8 angstrom çözünürlükte RNA polimeraz II. Science 292:1863–1876, 2001. D, From Zhang G, Campbell EA, Minakhin L, et al: Thermus aquaticus çekirdek RNA polimerazın kristal yapısı 3.3 A çözünürlükte Hücre 98:811-824, 1999.)


Bir promotör dizisinde çift sarmallı genomik DNA üzerine RNA polimerazın yüklenmesi, en iyi prokaryotlarda anlaşılır ve ökaryotların tartışılmasından önce tartışılır. Başlatma, bir dizi tanımlanmış adımda gerçekleşir (Şekil 15-1). İlk olarak, holoenzim çift sarmallı promotöre bağlanır ve kapalı kompleks denilen şeyi oluşturur. Bu etkileşimin özgüllüğü ve gücü, σ faktörü ile promotörün -10 ve -35 elementlerindeki bazlar arasındaki diziye özgü temaslar tarafından belirlenir (Şekil 15-6). Başlatmadaki ikinci adım, transkripsiyon başlangıç ​​bölgesi etrafındaki 14-bp'lik bir bölgenin eşleşmediği, bir transkripsiyon kabarcığı üreten bir açık kompleksin oluşumudur. Bu eşleşmemeye, aktif bölgede tek iplikli DNA şablonunu konumlandıran ve DNA-bağlanma yarığını daraltan ve polimeraz kelepçesini etkin bir şekilde kapatan polimerazda konformasyonel bir değişiklik eşlik eder. Bir sonraki adımda, aktif bölgedeki DNA şablonu, ilk iki ribonükleotit ile baz çiftleri oluşturur ve birinci fosfodiester bağı katalize edilir. Bu işlem, yeni oluşan RNA sekiz ila dokuz baz uzunluğa ulaşana kadar tekrarlanır, bu noktada büyüyen RNA zincirine bazların eklenmesi, RNA-DNA hibridinin bir bazının eşleşmemesiyle sonuçlanır ve yeni oluşan RNA, içinden çıkmaya başlar. polimerazın yüzeyinde bir kanal. Polimerazda ortaya çıkan konformasyonel değişiklik, σ faktörünün salınmasına ve RNA polimeraz, DNA şablonu ve yeni oluşan RNA'yı içeren kararlı bir üçlü (üç yollu) kompleksin oluşumuna yol açar.


RNA polimeraz II GTF'ler, toplam moleküler ağırlığı 106 D'den fazla olan 20'den fazla polipeptit içerir (Tablo 15-1). RNA polimeraz II'nin in vitro transkripsiyonu başlatmadan önce, promotörde düzenli bir faktör montajı meydana gelmelidir. RNA polimeraz II ön başlatma kompleksinin montajı, TATA kutu bağlama proteininden (TBP) oluşan büyük bir faktör (~700 kD) olan TFIID'nin bağlanmasıyla başlar ve TAFII'ler olarak adlandırılan bir dizi TBP ile ilişkili faktör (Şekil 15-7A) . TBP tek başına bazal transkripsiyon için yeterlidir, TAF'lar ise görünüşte transkripsiyonun daha fazla aktivasyonu için hedefler olarak hizmet eder (sonraki bölümlere bakınız). TBP, başlangıç ​​süreci sırasında belirli bir DNA dizisini tanıyan bazal transkripsiyon makinesindeki ilk polipeptittir. DNA bağlanması, bir dyad simetri eksenine sahip eyer şeklinde bir monomer oluşturan yüksek oranda korunmuş bir C-terminali 180-amino-asit alanı tarafından sağlanır (Şekil 15-7B). TBP "semerinin" alt tarafı, süreçte açık olarak gösterilen TATA dizisinin küçük oluğuna bağlanır. Fenilalanin yan zincirlerinin araya girmesiyle TATAAA elemanının her bir ucunda belirgin bir DNA bükülmesi üretilir (Şekil 15-7C).


(B–D, PDB dosyası: 1VOL. TBP + DNA koordinatları Stephen Burley'in izniyle, Rockefeller Üniversitesi, New York.)


Sonuçlar

Posta kodu bağlayıcı proteinlerin tanımlanması

β-aktin mRNA'nın posta koduna bağlanan proteinleri tanımlamak için RNA mobilite kayması ve UV çapraz bağlama yaklaşımları kullanıldı (Ross ve diğerleri, 1997). RNA mobilite kaydırma deneyleri için radyo etiketli posta kodu transkriptleri kullanıldı. Etiketli posta kodu probu beyin veya fibroblast özleri ile inkübe edildiğinde üç farklı RNA'nın protein kompleksi oluşturuldu (Şekil 1 A, şerit 1'in 1'x020134 kompleksleri oklarla gösterilmiştir). Kaydırılan komplekslerin yoğunluğu, kullanılan beyin özü miktarıyla orantılıydı (şerit 1𠄳). Hızlı göç eden kompleks (F) hem beyin hem de fibroblast özütlerinde görüldü (sırasıyla şerit 3 ve 4). Bununla birlikte, daha yavaş göç eden iki kompleks (M ve S), beyinde fibroblast ekstraktlarından (şerit 3 ve 4) daha belirgindi. Komplekslerin özgüllüğü, 100 kat fazla etiketlenmemiş posta kodunun komplekslerin oluşumu ile rekabet ettiği (şerit 5), pGEM 3Z vektöründen kopyalanan 100 kat fazla etiketlenmemiş RNA'nın kompleks ile etkileşime girmediği rekabet deneyleri ile belirlendi. oluşumu (yayınlanmamış veriler).

Tavuk embriyo beyni ve fibroblast ekstraktlarında posta koduna bağlanan proteinlerin karakterizasyonu. (A). Beyin ve fibroblastlardan oluşan kompleksler. Tavuk β-aktin mRNA'sının 3'x02032 UTR'sinin 54 nts posta kodunu kodlayan [32 P] etiketli transkriptler, tavuk embriyo beyni ve fibroblast protein ekstraktları ile inkübe edildi, ardından RNase T1 (50 U/ml) ile inkübe edildi. ) ve heparin (5 mg/ml). RNA'nın protein kompleksleri, daha sonra kurutulan ve Kodak X-Ray filmine maruz bırakılan %4 poliakrilamid doğal jellerde çözüldü. (Şerit 1, 2 ve 3) [32 P]-etiketli transkript, sırasıyla 1-, 2- ve 5-μl beyin özleri ile inkübe edildi. (Şerit 4) [32 P]-etiketli transkript, 5 μl fibroblast özü ile inkübe edildi. (Şerit 5) [32 P]-etiketli transkript, 100'x000d7 fazla molar miktarlarda etiketlenmemiş 3'x02032 UTR aktin mRNA transkriptlerinin varlığında 5-μl beyin özü ile inkübe edildi. Oklar, yavaş (S), orta (M) ve hızlı göç eden (F) RNA'nın protein komplekslerini gösterir. (B) Posta kodu için komplekslerin özgüllüğü. (Şerit 1) Beyin özü ile inkübe edilmiş posta kodu. (Şerit 2) Beyin özü ile inkübe edilmiş mutant posta kodu. (C) UV çapraz bağlama deneyi. [32P]-etiketli transkriptler beyin özü ile inkübe edildi, RNase T1 ile işlendi ve 1 cm mesafeden 3 dakika UV ışığına maruz bırakıldı. RNA protein komplekslerinin (F, M ve S) her biri tanımlandı ve %4 poliakrilamid doğal jelden çıkarıldı, SDS tamponuna batırıldı ve %10 SDS-PAGE'de çözüldü. (Soldaki üç şerit) Kesilmiş RNA'nın UV çapraz bağlı olmayan protein kompleksleri F, M ve S. (Sağ üç şerit) Kesilmiş RNA'nın çapraz bağlanmış protein kompleksleri F, M ve S. Oklar, etiketli RNA'ya bağlı protein hareketliliklerini gösterir.

Mutasyona uğramış bir posta kodu, raportör mRNA'yı lokalize edemediğinden (Ross ve diğerleri, 1997), mutant posta kodunun bir RNA protein kompleksi oluşturmayacağını düşündük. Bunu test etmek için, iki ACACCC motifinin GTGTGT ile değiştirildiği radyoaktif mutant posta kodu ürettik ve beyin özleri ile RNA mobilite kaydırma deneyleri gerçekleştirdik (Şekil 1 B). Vahşi tipteki posta kodunun (şerit 1) aksine, mutant posta kodu, RNA–protein kompleksleri oluşturamadı (Şekil 1 B, şerit 2). Bu, beyin özündeki proteinlerin mutant posta koduna bağlanmadığını gösterdi ve mRNA lokalizasyonunu bozan bir mutasyonun, RNA'nın bağlayıcı proteininin bozulmuş bağlanmasıyla ilişkilendirilebileceğini gösterdi. Posta koduna bağlanan protein bileşenlerini ayırt etmek için, radyo etiketli posta kodunun beyin özleri ile karıştırılmasıyla oluşturulan RNA'nın protein komplekslerini çapraz bağlamak için UV kullandık ve kompleksleri SDS-PAGE ile analiz ettik. Üç RNA'nın protein kompleksinin tümü, çapraz bağlanma olmadan saptanabilir değildi (Şekil 1 C, UV-X yok). RNA'nın protein kompleksleri çapraz bağlanıp stabilize edildiğinde, spesifik bantlar görselleştirildi (UV-X). Kompleks F, tahmini moleküler kütlesi � kD olan, ZBP1 ile aynı moleküler kütleye sahip çapraz bağlı bir protein içeriyordu (Ross ve diğerleri, 1997). M ve S kompleksleri (beyinle zenginleştirilmiş bantlar), tahmini moleküler kütlesi � kD olan çapraz bağlı bir protein içeriyordu. Doğal jeldeki M ve S komplekslerinin göç farkı ve SDS-PAGE üzerindeki moleküler kütledeki özdeşlik, kompleks S'nin kompleks M'nin bir dimeri olabileceğini düşündürdü. Bu verilerden, 68- ve 92-kD proteinlerinin bağlandığı sonucuna varıyoruz. posta koduna, β-aktin mRNA lokalizasyon sinyali. 68-kD bandı muhtemelen ZBP1'dir, ancak diğer ZBP tercihen beyinde eksprese edilir. 92-kD proteini ZBP2 olarak adlandırıldı. Ayrı komplekslere ayrılmaları, ZBP1 ve ZBP2'nin aynı anda posta koduna bağlanmadığını gösterir.

ZBP'lerin saflaştırılması

Beyin açısından zenginleştirilmiş proteini tanımlamak için RNA afinite seçim tekniklerini kullanarak ZBP'leri saflaştırdık. Beyin veya kültürlenmiş fibroblast özlerini, posta kodu RNA içeren bir afinite kromatografisi sütunundan geçirdik. Kapsamlı yıkamalardan sonra, kolon üzerinde kalan proteinler artan tuz konsantrasyonu aşamaları ile ayrıştırıldı ve gümüş boyama ile SDS-PAGE ile analiz edildi (Şekil 2 A). Başlangıç ​​özütü ve akış fraksiyonu heterojen olmasına rağmen (Şekil 2 A, şerit 1), bir dizi yıkamadan sonra (şerit 2𠄵), spesifik proteinler artan tuz koşullarıyla ayrıştırıldı (Şekil 2 A, şerit 7'ler). x020139). 1 ve 2 M KCl ile ayrıştırılan protein fraksiyonu, farklı protein bantları içeriyordu (Şekil 2 A, şerit 8 ve 9, oklar) üç protein 68 kD ve biri 92 kD idi. Tahmini moleküler kütleler, SDS-PAGE tarafından tanımlanan UV çapraz bağlı RNA'nın protein komplekslerininkiyle yakın bir uyum içindeydi (Şekil 1 B). Daha düşük moleküler kütleli bir protein (53 kD) daha önce de tespit edilmişti (Ross ve diğerleri, 1997).

RNA afinite kromatografisi ile parçalanan proteinlerin analizi. (A) SDS-PAGE analizi. RNA afinite kromatografisinden ayrıştırılan her saflaştırma adımındaki proteinlerin alikuotları (30 μx003bcl) %10 SDS-PAGE içinde çözüldü. (Şerit 1) Akış oranı. (Şerit 2𠄶) Proteinler, sırasıyla beş ardışık yıkama adımında. (Şerit 7𠄹) Sırasıyla 0.5, 1.0 ve 2.0 KCl elüsyon fraksiyonlarında proteinler. Protein moleküler kütlesi doğru konumda işaretlenmiştir. Küçük oklar, mikro-sıralanmış olan beş proteini gösterir. (B) Afinite seçilen proteinleri kullanarak jel kaydırma deneyi. A'da (fraksiyon) olduğu gibi her birinin alikuotları (5 μl), 1 × 105 CPM [32 P] etiketli posta kodu transkripti ile inkübe edildi ve oluşan kompleksler, %4 doğal jellerde çözüldü. (C) Başlangıç ​​malzemesi. Oklar, Şekil 1 A'da tanımlanan RNA protein komplekslerini temsil etmektedir.

RNA afinite sütunundan ayrıştırılan proteinlerin RNA bağlama aktivitesi içerip içermediğini belirlemek için, radyoetiketli posta kodunu saflaştırma adımlarının her birinden proteinlerle inkübe ederek bant mobilite kaydırma analizini gerçekleştirdik (Şekil 2B). Başlangıç ​​materyali ile karşılaştırıldığında (Şekil 2 B, hat C), 1- ve 2-M KCI fraksiyonlarında (şerit 7 ve 8) arttırılmış RNA bağlanma aktivitesi tespit edildi. RNA bağlama aktivitesi, akış (Şekil 2 B, şerit 2), yıkama adımlarında (Şekil 2 B, şerit 3𠄶) ve 0.5-M KCl fraksiyonunda (Şekil 2 B, şerit 6) bulunmadı. ), RNA afinite saflaştırmasından sonra RNA bağlayıcı proteinlerin 1- ve 2-M KCl fraksiyonlarında zenginleştiğini gösterir. Şaşırtıcı bir şekilde, 1- ve 2-M KCl fraksiyonları 92- ve 68-kD proteinleri içermesine rağmen, radyo-etiketli posta kodu ile inkübasyondan sonra sadece kompleks M ve S oluşturuldu (Şekil 2 B, şerit 8 ve 9). Bant kaydırma deneyinde kompleks F'nin nispi yokluğu, ya 68-kD proteinin yüksek tuz elüsyon koşulunda RNA bağlama aktivitesini kaybettiğini ya da 68-kD proteinin posta koduna bağlanmasının, mevcut olmayan ek proteinlere ihtiyaç duyduğunu veya yüksek tuz fraksiyonunda aktiftir.

Afinite ile saflaştırılmış proteinlerin mikro dizilimi

RNA afinite kolonunun 2-M KCl fraksiyonundaki proteinler (Şekil 2 A, şerit 9) bir centron-30 filtresi ile konsantre edildi, %12 SDS-PAGE'de çözüldü ve Coomassie mavi boyama ile görselleştirildi. Dört protein bandı �, 70, 65 ve 45 kD jelden ayrıştırıldı ve mikro-sıralandı. ZBP2 adını verdiğimiz saflaştırılmış 92-kD proteinin altı peptidi, mikro dizilemeden sonra elde edildi. ZBP2'nin peptit dizileriyle yapılan bir veri tabanı araştırması, altı peptitin, daha önce düzenleyici bir birleştirme faktörü olarak tanımlanmış olan bir insan nükleer proteini olan KSRP ile eşleştiğini ortaya çıkardı (Min ve diğerleri, 1997). Diğer üç protein de peptit dizileriyle tanımlandı. 70-kD proteini, bir insan proteini olan FBP'nin bir homologuydu ve bu protein, transkripsiyon faktörü olarak biliniyordu. c-myc gen (Duncan ve diğerleri, 1994). 65 kD proteini bilinmeyen bir proteindi. Bu proteinin ZBP1 olduğunu varsaydığımız için 68-kD proteini sıralamadık (Ross ve diğerleri, 1997). 45-kD proteini, tavukta tek zincirli bir DNA bağlama faktörü olan ssDBF olarak tanımlandı (Smidt ve diğerleri, 1995) ve bir insan proteini olan ABBP'ye homologdu; mRNA düzenleme (Lau ve diğerleri, 1997).

ZBP2 için tavuk cDNA'sının izolasyonu

cDNA kodlayan ZBP2, üç tavuk cDNA kitaplığının taranması ve cDNA uçlarının hızlı amplifikasyonu (RACE) - 5'x02032 terminalinin PCR amplifikasyonu ile elde edildi. ZBP2 ve insan KSRP'si, nükleik asit dizisinde %81'lik bir özdeşliği ve amino asit (aa) dizisinde %8'lik bir özdeşliği paylaşır (Şekil 3), bu da ZBP2/KSRP'nin yüksek oranda korunmuş bir protein olduğunu gösterir. İnsan KSRP ve ZBP1'de olduğu gibi, ZBP2 ayrıca dört hnRNP tip K homoloji RNA bağlama (KH) alanı ve glutaminlerle zenginleştirilmiş bir COOH-terminal bölgesi, bir AWEEYYK motifinin dört tekrarı ve bir NH içerir2-terminal prolin-glisin açısından zengin alan (Şekil 3). Bununla birlikte, tavuk ZBP2, KSRP'de bulunmayan ilk KH alanından önce bir 47-aa segmenti ve mRNA'nın 5′ ucunda önemli dizi farklılıkları içerir.

İnsan KSRP ile karşılaştırıldığında tam ZBP2 dizisi. Şekil 2'de gösterildiği gibi RNA afinite kolonunun 2.0 KCl elüsyon fraksiyonundaki proteinler, bir contricon-30 filtresi (Amicon) ile konsantre edildi ve %10 SDS-PAGE içinde elektroforezlendi. Coomassie mavisi boyaması ile görselleştirilen proteinler, mikro dizileme için çıkarıldı. Altı çizili diziler, saflaştırılmış ZBP2'nin (92 kD) 16, 13, 13, 7 ve 24 aa'lık beş mikro-dizili peptidini göstermektedir. Kırmızı bölgeler, hnRNP'nin yüksek oranda korunmuş dört K homoloji alanını gösterir. Prolin, glisin açısından zengin NH'ye dikkat edin2ZBP2'nin -terminal ve glutamin açısından zengin COOH-terminal alanları. ZBP2 ve KSRP'nin özdeşliği %86'dır. ZBP2, GenBank/EMBL/DDBJ/erişim no. <"type":"entrez-nükleotid","attrs":<"text":"AF461020","term_id":"18252631">> AF461020.

ZBP2, tavuk beynindeki ve fibroblastlardaki posta koduyla ilişkilidir.

ZBP2'nin mRNA lokalizasyonundaki rolüyle ilgili çalışmalarımızı kolaylaştırmak için jel ile saflaştırılmış ZBP2'yi sıçanlara enjekte ederek antikorlar ürettik. ZBP2 antikorlarının özgüllüğü, ZBP2'ye karşı sıçan antikorlarının ZBP2'yi hem fibroblast hem de beyin özütlerinde ve ayrıca afinite ile saflaştırılmış protein fraksiyonlarında spesifik olarak tanıdığı Western blot analizi (Şekil 4A) ile belirlendi (Şekil 4A, şerit 1𠄳).

ZBP2'ye karşı antikorların karakterizasyonu. ZBP2'ye karşı antikorlar, sıçanlara SDS-PAGE jel ile saflaştırılmış ZBP2 enjekte edilerek yapılmıştır. (A) ZBP2'ye Western blotlama. (Şerit 1) Ham beyin özü. (Şerit 2) Ham fibroblast özü. (Şerit 3) 1.0 M KCl afinitesi ile saflaştırılmış beyin ekstraktının protein fraksiyonu. Ok ZBP2'yi gösterir. (B) ZBP2'ye karşı antiserum veya bağışıklık öncesi serum, 2 saat boyunca beyin özü ile inkübe edildi, ardından agaroz-protein G boncukları ile 2 saat boyunca 4 °C'de inkübe edildi. 1.500 rpm'de 10 dakika santrifüj edildikten sonra süpernatanlar, bir RNA protein kompleksi oluşturma yetenekleri açısından hareketlilik kayması tahlili ile analiz edildi. (Şerit 1) Kontrol beyin özü. (Şerit 2) Sıçan bağışıklık öncesi serumu ile inkübe edilen beyin özü. (Şerit 3) Anti-ZBP2 serumu ile inkübe edilen beyin özü. Oklar, Şekil 1 A'da tanımlanan RNA'nın protein komplekslerini gösterir. (C) Western blotlama için B'deki ile aynı numuneler kullanıldı. (Şerit 1) Kontrol beyin özü. (Şerit 2) Sıçan bağışıklık öncesi serumu ile inkübe edilen beyin özü. (Şerit 3) beyin özütü, anti-ZBP2 serumu kullanılarak bağışıklığı azaltıldı. Ok, ZBP2'yi gösterir.

Beyin özütlerindeki ZBP2'nin posta koduyla M ve S komplekslerini oluşturan protein olduğundan emin olmak için, beyin özütlerinden ZBP2'yi bağışıklığı azalttık ve RNA'nın protein komplekslerini saptamak için RNA mobilite kaydırma deneyleri gerçekleştirdik (Şekil 4 B). ZBP2 antikorları ile bir immünopresipitasyondan elde edilen süpernatanlar posta kodu ile inkübe edildiğinde, spesifik RNA'nın protein kompleksleri M ve S büyük ölçüde azaldı (Şekil 4 B, şerit 3). Anti-ZBP2 antikorları ile immünopresipitasyon, kompleks F sadece biraz azaltıldığından spesifik olarak göründü (Şekil 4 B, şerit 3). Buna karşılık, bir kontrol sıçanı ön-bağışıklık serumu ile imünopresipitasyondan sonra süpernatanlarla RNA mobilite kaydırma deneyi yapıldığında, beklenen RNA protein komplekslerinin yoğunluğunda bir azalma bulunmadı (Şekil 4 B, şerit 2). Bu, M ve S komplekslerinin oluşumunun ZBP2'nin varlığına bağlı olduğunu doğruladı. F kompleksinin oluşumu muhtemelen ZBP2 antikorları tarafından tanınmayan ZBP1'e bağlıydı. ZBP2'nin anti-ZBP2 antikorları içeren ekstraktlardan bağışıklığının azaldığını doğrulamak için, yukarıdaki mobilite kaydırma deneyinde kullanılan aynı süpernatanlar Western blot ile analiz edildi (Şekil 4C). Sonuç, kontrol ve sıçan bağışıklık öncesi serumu ile tedavi edilen süpernatanların (Şekil 4C, şerit 1 ve 2) aksine, ZBP2'nin anti-ZBP2 antikorları tarafından çıkarıldığını gösterdi (Şekil 4C, şerit 3).

ZBP2'nin gelişimsel düzenlemesi

Gelişmekte olan nöronlarda ZBP2 ekspresyon paternini belirlemek için tavuk beyninin farklı gelişim aşamalarından protein ekstraktları hazırlandı ve Western blot ile ZBP2 seviyeleri için analiz edildi (Şekil 5). ZBP2'nin en yüksek ekspresyonu 6 günlük embriyolarda görüldü (Şekil 5, ​ ,6 6 d), ekspresyon seviyesi kuluçkadan önce %30'a düşürüldü ve sonrasında stabil kaldı (Şekil 5). Buna karşılık, aynı zaman noktalarında β-aktin proteininin miktarı neredeyse sabittir. Bu, aksonlar ve dendritlerin maksimum büyümede olduğu nöral embriyogenez sırasındaki olaylarla tutarlıdır ve ayrıca ZBP1'in (yayınlanmamış veriler) ifadesi ile çakışmaktadır.

ZBP2'nin embriyonik ifadesi. Proteinler tavuk embriyo beyinlerinden çeşitli aşamalarda ekstrakte edildi ve ZBP2 ve β-aktin antikorları kullanılarak Western blotlamadan önce %10 SDS-PAGE üzerinde çalıştırıldı.Aktin yoğunluğu başına ZBP2'nin nispi oranları, belirtilen aşamalar için (gün olarak) hesaplandı.

dağılımı βCEF'lerde ve nöronlarda -aktin mRNA ve ZBP2. CEF'ler (A) ve nöronlar (B), Malzemeler ve yöntemler bölümünde açıklandığı gibi kültürlendi ve sabitlendi. Hücreler in situ β-aktin mRNA'ya (Cy3, kırmızı) ve immünofloresan yoluyla ZBP2'ye (FITC, yeşil) hibridize edildi. Örtüşme, A'nın sağında ve B'de belirtilmiştir. B'deki görüntü, üst üste bindirilmiş tek, çözülmüş optik bölümlerdir. Ok uçları, nöronal süreçlerde ve büyüme konisinde ZBP2 ve β-aktin mRNA'nın birlikte yerleşimini gösterir. Barlar, 10 μm.

ZBP2'nin hücresel lokalizasyonu

ZBP2'nin hücre altı lokalizasyonunu ve ZBP2'nin in vivo fibroblastlarda ve nöronlarda β-aktin mRNA ile ilişkili olup olmadığını araştırmak için, β-aktin mRNA için floresan etiketli oligo nükleotit probları ile in situ hibridizasyonu kullanarak birleşik bir tahlil gerçekleştirdik. (kırmızı Şekil 6, A , sol panel ve B) ve ZBP2 için antikorlarla (yeşil Şekil 6, A , orta panel ve B). ZBP2 ağırlıklı olarak hücre çekirdeğinde bulunur. Bununla birlikte, zaman zaman önemli miktarda ZBP2, CEF'lerin ön kenarında ve tavuk gelişmekte olan nöronların büyüme konisinde immünofloresan ile tespit edildi. Görüntülerini (Şekil 6, A, sağ ve B) ZBP2 ve β-aktin mRNA'nın CEF'lerin ön kenarında (Şekil 6 A, sağ) ve nöronların büyüme konisinde üst üste bindirildiği (sarı) üst üste bindirdik. ( Şekil 6 B, oklar). Bu, ZBP2 ve β-aktin mRNA'nın incelenen hücrelerde in vivo olarak uzaysal olarak ilişkili olduğuna dair kanıt sağladı. Protein ve RNA genellikle nöritlerin aynı bölgesinde dağılmış olsa da, bazen örtüşürler. Hem β-aktin mRNA'sı hem de ZBP2, özellikle nöronlarda belirgin olan noktasal bir dağılım gösterir ve bu, parçacıkların lokalize edilmesine ilişkin gözlemlerle tutarlıdır (Ainger ve diğerleri, 1993 Zhang ve diğerleri, 2001).

ZBP2 ve β-aktin mRNA fiziksel olarak ilişkilidir

ZBP2 ve β-aktin mRNA'nın fiziksel olarak ilişkili olup olmadığını belirlemek için, immünopresipitasyon ve ardından anti-ZBP2 antikorları ile immüno-çökeltilmiş peletin β-aktin mRNA içerip içermediğini belirlemek için RT-PCR tahlilleri kullandık (Şekil 7). RNA, ya anti-ZBP2 antikorları ya da sıçan ön-bağışıklık serumu kullanılarak beyin özünden elde edilen immüno-çökeltilmiş peletten izole edildi ve daha sonra RT-PCR'ye tabi tutuldu. PCR amplifikasyonu için β-aktin mRNA 3′ çevrilmemiş bölgenin (UTR) 398-bp'lik bir fragmanı seçildi. Negatif kontrol olarak β-aktin cDNA'sı olmayan bir plazmit (Şekil 7, şerit 1) ve pozitif kontrol olarak β-aktin cDNA'sı olan bir plazmit kullandık (Şekil 7, şerit 6). β-aktin mRNA'nın 3'x02032 UTR'sinin bir parçası, ZBP2 antiserum veya antikorları ile immünopresipitasyonlardan amplifiye edildi (Şekil 7, şerit 3 ve 5). Preimmün sıçan serumu veya IgG ile immünopresipitasyonlar, herhangi bir PCR amplifiye DNA fragmanı göstermedi (Şekil 7, şerit 2 ve 4). Bu deney, β-aktin mRNA ve ZBP2'nin büyük olasılıkla tavuk beyni ekstraktlarında fiziksel olarak birbiriyle ilişkili olduğunu gösterdi.

β-aktin mRNA, ZBP2 ile birlikte çöktürüldü. ZBP2 antikorları, bir CEF özütünün immüno-çökeltilmesi için kullanıldı. Peletlerde β-aktin mRNA'nın varlığını saptamak için bir RT-PCK tahlilinde β-aktin mRNA'sına yönelik primerler kullanıldı. (Şerit 1) Negatif PCR kontrolü primer yok. (Şerit 2) Bağışıklık öncesi sıçan serumu. (Şerit 3) ZBP2 antiserumu. (Şerit 4) Saflaştırılmış sıçan normal IgG. (Şerit 5) afinite ile saflaştırılmış ZBP2 IgG. (Şerit 6) Şablon olarak β-aktin mRNA'nın tam uzunlukta cDNA'sı kullanılarak pozitif PCR kontrolü. M, DNA moleküler markörüdür. Ok, β-aktin mRNA'nın 3′ UTR'sinin PCR ile amplifiye edilmiş DNA fragmanını gösterir.

ZBP2'nin bölümleri nükleer ve sitoplazmik dağılımı belirleyebilir

ZBP2'nin çekirdek ve sitoplazma arasında gidip gelmediğini belirlemek için, onu gelişmiş yeşil flüoresans proteinine (EGFP) kaynaştırdık ve flüoresan proteinin hem fibroblastlarda hem de nöronlarda bölümlenmesini analiz ettik. GFP'ye kaynaştırılan çeşitli ZBP2 bölümleri 47-aa segmentini (kırmızı), merkezi dört KH alanını (mavi) ve COOH-terminal tekrarlarını (gri) içeriyordu (Şekil 8 A). ZBP2'nin farklı alanları, kendisine kaynaşmış EGFP'nin nükleer veya sitoplazmik bölümlenmesini kontrol eder (sayılar, fibroblastlarda sitoplazmik floresanlı hücrelerin yüzdesini gösterir). COOH-terminali ( Şekil 8 B) alanı ve dört KH alanı ( Şekil 8 D) hücre boyunca dağıtıldı, oysa 47 aa, merkezi alan dediğimiz 4-KH alanına eklendiğinde, lokalizasyon neredeyse tamamen nükleerdi ( Şekil 8 C). Bu, 47 aa'nın nükleer dağılımı belirlediğini ileri sürdü. Bu, 47-aa segmentinin daha sonra yalnızca nükleer hale gelen EGFP ile birleştirilmesiyle doğrulandı ( Şekil 8 E). 47-aa segmentinin incelenmesi, bir nükleer lokalizasyon sinyalini (NLS) düşündüren birkaç arginin tortusu ortaya çıkardı. Tam uzunluktaki ZBP2, 47-aa segmenti olsun veya olmasın GFP'ye kaynaştırıldığında (Şekil 8, F ve G), nükleer flüoresans azaldı ancak 47 aa'sız yapıda elimine edilmedi ve sitoplazmik flüoresans arttı , zayıf NLS'lerin büyük olasılıkla proteinin başka bir yerinde bulunduğunu gösterir. Bu son iki yapı için fibroblastlardaki dağılım, nöronlarda ölçüldü ve sitoplazmik floresanlı hücrelerin aynı yüzdelerini verdi. ZBP2'den farklı olarak, insan KSRP'si, GFP ile birleştiğinde ve CEF'de (yayınlanmamış veriler) ifade edildiğinde tamamen nükleerdi.

ZBP2'nin fibroblastlarda ve nöronlarda nükleer ve sitoplazmik dağılımı. ZBP2'nin gen yapısı A. Kırmızı çubuk, 47-aa ek mavi çubuklar, KH alanları gri çubuklar, AWEEYYK motifinin COOH-terminal tekrarında gösterilmiştir. ZBP2'nin çeşitli yapıları, 47-aa eki (F ve G), 47-aa eki (E), dört KH alanı (D), dört KH alanını içeren merkezi alan ve 47-aa eki (C) veya proteinin (B) COOH terminusu GFP'ye kaynaştırıldı ve hücresel dağılım karakterize edildi. Yapılar, sağ panellerde hücresel dağılımlar ile sol panellerde detaylandırılmıştır. Sitoplazmik sinyale sahip hücrelerin yüzdesi, her yapı altındaki sayıdaki her yapı için karakterize edildi. Barlar, 10 μm.

ZBP2 merkezi alanının aşırı ekspresyonu, CEF'lerde ve nöronlarda β-aktin mRNA lokalizasyonunu kısmen bozar

Dört KH alanına sahip 47 aa dahil olmak üzere � aa içeren merkezi alan olan ZBP2'nin bir kesik kısmı (Şekil 8 C), CEF'lere transfekte edildi. KH alanlarının, ZBP1'e (yayınlanmamış veriler) benzer şekilde tam uzunluktaki ZBP2 ile RNA bağlanması için rekabet edeceğini ve dolayısıyla β-aktin mRNA lokalizasyonu için baskın bir negatif olarak hareket edeceğini varsaydık. Kesik ile transfekte edilmiş fibroblastlardaki EGFP sinyali esas olarak çekirdekte mevcuttu. β-aktin mRNA'nın lokalizasyonu, floresan in situ hibridizasyon ile görselleştirildi. Lokalize β-aktin mRNA'sı olan hücrelerin yüzdesi, kontrol olarak EGFP veya EGFP-KSRP ile transfekte edilmiş hücrelerin (insan ZBP2 homologu) aksine, transfekte edilmiş CEF'lerde (Şekil 9, üstte) kabaca yarı yarıya azaldı. β-aktin mRNA'nın sitoplazmik sinyalinin yoğunluğu önemli ölçüde değişmedi, bu da β-aktin mRNA'nın nükleer ihracatının baskın negatif yapı (yayınlanmamış veriler) tarafından inhibe edilmediğini gösterir. Transfekte edilmiş gelişmekte olan nöronlarda, bu kesilme aynı zamanda kontrol deneyi ile karşılaştırıldığında süreçlerde veya büyüme konilerinde β-aktin mRNA sinyalinde %35'lik bir azalmaya neden oldu (Şekil 9, orta). Bu, kesilmiş, ancak yine de nükleer olan ZBP2'nin aşırı ekspresyonunun β-aktin mRNA lokalizasyonunu etkilediğini gösterdi. ZBP2 kesilmesinin baskın olumsuz etkisinin spesifik olduğunu göstermek için, hem tam uzunluktaki ZBP2'nin hem de merkezi alanın CEF'lere transfeksiyonlarını gerçekleştirdik. Transfekte edilmiş hücrelerde β-aktin mRNA'nın delokalizasyonu, vahşi tip ZBP2 kullanılarak kısmen kurtarıldı (Şekil 9, alt).

Bir ZBP2 baskın negatif yapı bastırır β-aktin mRNA lokalizasyonu. (Üst) Lokalize β-aktin mRNA ile transfekte edilmiş CEF'lerin yüzdesi. CEF'ler 6 saat boyunca transfekte edildi, ardından floresan in situ hibridizasyon yapıldı. Transfekte edilmiş hücreler, β-aktin mRNA lokalizasyonu için puanlandı. GFP, vektör pEGFPC1 GFP-CD, GFP merkezi alan GFP-KSRP ile kaynaşmış, GFP-insan KSRP Sahte, plazmit yok. Çubuklar, her deneyde lokalize β-aktin mRNA'sı ile transfekte edilmiş hücrelerin yüzdesini gösterir. En az 50 transfekte edilmiş hücre, her biri iki deney olmak üzere her lamelde sayıldı. (Ortada) Nöronal süreçlerdeki β-aktin mRNA sinyali. Deneyler, ZBP2'nin COOH terminalinin (GFP-CT) kullanılması dışında A'ya paraleldi (Şekil 8, yapı B). β-aktin mRNA sinyali ölçüldü ve ardından floresan birimlerine dönüştürüldü. (Alt) Lokalize β-aktin mRNA'sı ile birlikte transfekte edilmiş CEF'lerin yüzdesi. CEF'ler, 6 saat boyunca tek yapı (yabani tip ZBP2 veya baskın negatif merkezi alan yapısı) veya farklı oranlarda her iki yapı (baskın negatife karşı vahşi tip 1:1 veya 1:4) ile transfekte edildi. FISH'den sonra, transfekte edilmiş hücreler Şekil 9 A'daki gibi puanlandı.


Mükemmellik Merkezi SymBioSys (Araştırma Konseyi KULeuven EF/05/007) tarafından alınan fon için minnettarız, IWT-SBO 120050 hibesi kapsamında Flanders'ta Bilim ve Teknoloji Yoluyla Yeniliğin Teşvik Edilmesi Enstitüsü'nün Stratejik Temel Araştırması ( NEMOA) ve FWO [Bilimsel Araştırma Fonu – Flanders (Belçika)], HS'ye doktora sonrası burs aracılığıyla.

Ayba, H. (2007). Hfq bağlayıcı küçük RNA'lar tarafından RNA susturma mekanizması. Kör. Görüş. Mikrobiyol. 10, 134�. doi: 10.1016/j.mib.2007.03.010

Anderson, P.E., Gober J.W. (2000). Caulobacter crescentus'ta flagellin sentezinin transkripsiyon sonrası düzenleyicisi olan FlbT, flagellin mRNA'nın 5'in çevrilmemiş bölgesi ile etkileşime girer. Mol. Mikrobiyol. 38, 41�. doi: 10.1046/j.1365-2958.2000.02108.x

Arthur, D.C., Ghetu, A.F., Gubbins, M.J., Edwards, R.A., Frost, L.S. ve Glover, J.N.M. (2003). FinO, duyu-antisens RNA etkileşimlerini kolaylaştıran bir RNA şaperonudur. EMBO J. 22, 6346�. doi: 10.1093/emboj/cdg607

Aymerich, S. ve Steinmetz, M. (1992). BglG / SacY ailesinin bakteriyel antiterminatör proteinlerinin RNA hedefindeki özgünlük belirleyicileri ve yapısal özellikler. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 89, 10410�. doi: 10.1073/pnas.89.21.10410

Babitzke, P. (2004). Bir RNA bağlayıcı proteinin allosterik kontrolü ile transkripsiyon zayıflamasının ve translasyonun başlatılmasının düzenlenmesi: basil subtilis TRAP proteini. Kör. Görüş. Mikrobiyol. 7, 132�. doi: 10.1016/j.mib.2004.02.003

Babitzke, P., Bear, D.G. ve Yanofsky, C. (1995). TRAP, trp RNA bağlayıcı zayıflama proteini basil subtilis, iki nükleotitle ayrılmış GAG veya UAG tekrarlarını içeren transkriptleri bağlayan toroid şekilli bir moleküldür. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 92, 7916�. doi: 10.1073/pnas.92.17.7916

Babitzke, P., Stults, J.T., Shire, S.J. ve Yanofsky, C. (1994). TRAP, trp RNA bağlayıcı zayıflama proteini basil subtilis, trpEDCFBA ve trpG transkriptlerinde G/UAG tekrarlarını tanıdığı görülen çok alt birimli bir komplekstir. J. Biol. Kimya 269, 16597�.

Bachem, S. ve St'x000FClke, J. (1998). Yönetmeliği basil subtilis Fosfotransferaz sisteminin bileşenleri tarafından GlcT antiterminatör proteini. J. Bakteriyol. 180, 5319�.

Bae, W., Xia, B., Inouye, M. ve Severinov, K. (2000). Escherichia koli CspA ailesi RNA şaperonları, transkripsiyon antiterminatörleridir. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 97, 7784�. doi: 10.1073/pnas.97.14.7784

Baker, C.S., E'x000F6ry, L.A., Yakhnin, H., Mercante, J., Romeo, T. ve Babitzke, P. (2007). CsrA, translasyon başlangıcını inhibe eder Escherichia koli hfq, Shine-Dalgarno dizisiyle örtüşen tek bir siteye bağlanarak. J. Bakteriyol. 189, 5472�. doi: 10.1128/JB.00529

Baker, C.S., Morozov, I., Suzuki, K., Romeo, T. ve Babitzke, P. (2002). CsrA, glgC'nin translasyonunu önleyerek glikojen biyosentezini düzenler. Escherichia koli. Mol. Mikrobiyol. 44, 1599�. doi: 10.1046/j.1365-2958.2002.02982.x

Barria, C., Malecki, M. ve Arraiano, C.M. (2013). Soğuğa bakteri adaptasyonu. Mikrobiyoloji 159, 2437�. doi: 10.1099/mic.0.052209-0

Beyer, D., Skripkin, E., Wadzack, J. ve Nierhaus, K.H. (1994). Protein sentezi sırasında ribozomun mRNA boyunca nasıl hareket ettiği. J. Biol. Kimya 269, 30713�.

Brencic, A. ve Lory, S. (2009). Regulonun belirlenmesi ve yeni mRNA hedeflerinin tanımlanması Pseudomonas aeruginosa RsmA. Mol. Mikrobiyol. 72, 612�. doi: 10.1111/j.1365-2958.2009.06670.x

Browne, P., Barret, M., O’Gara, F. ve Morrissey, J.P. (2010). Crc regulonunun hesaplamalı tahmini, katabolit baskı kontrolünün cins çapında ve türe özgü hedeflerini tanımlar. Pseudomonas bakteri. BMC Mikrobiyol. 10:300. doi: 10.1186/1471-2180-10-300

Burrowes, E., Baysse, C., Adams, C. ve O’Gara, F. (2006). Düzenleyici protein RsmA'nın hücresel fonksiyonlar üzerindeki etkisi Pseudomonas aeruginosa PAO1, transkriptom analizi ile ortaya konduğu gibi. Mikrobiyoloji 152, 405�. doi: 10.1099/mic.0.28324-0

Callaghan, A.J., Marcaida, M.J., Stead, J.A., McDowall, K.J., Scott, W.G. ve Luisi, B.F. (2005). Yapısı Escherichia koli RNase E katalitik alanı ve RNA devri için çıkarımlar. Doğa 437, 1187�. doi: 10.1038/nature04084

Carpousis, A.J. (2007). RNA degradozomu Escherichia koli: RNase E üzerine monte edilmiş bir mRNA-bozucu makine. Annu. Rev. Mikrobiyol. 61, 71�. doi: 10.1146/annurev.micro.61.80706.093440

Chai, W. ve Stewart, V. (1999). NasR aracılı, nitrata duyarlı transkripsiyon antiterminasyonu için RNA dizisi gereksinimleri Klebsiella oksitoka M5al nasF operon lideri. J. Mol. Biol. 292, 203�. doi: 10.1006/jmbi.1999.3084

Chaulk, S., Lu, J., Tan, K., Arthur, D.C., Edwards, R.A., Frost, L.S., et al. (2010). N. meningitidis 1681, RNA şaperonlarının FinO ailesinin bir üyesidir. RNA Biol. 7, 812�. doi: 10.4161/rna.7.6.13688

Chaulk, S.G., Smith-Frieday, M.N., Arthur, D.C., Culham, D.E., Edwards, R.A., Soo, P., et al. (2011). ProQ, ProP seviyelerini kontrol eden bir RNA şaperonudur. Escherichia koli. biyokimya 50, 3095�. doi: 10.1021/bi101683a

Chen, Y. ve Anderson, D.M. (2011). ifade hiyerarşisinde Yersinia RNA'nın YopD tarafından tanınmasıyla kurulan tip III salgılama sistemi. Mol. Mikrobiyol. 80, 966�. doi: 10.1111/j.1365-2958.2011.07623.x

Christiansen, J.K., Larsen, M.H., Ingmer, H., S'x000F8gaard-andersen, L. ve Kallipolitis, B.H., (2004). RNA bağlayıcı protein Hfq Listeria monocytogenes: stres toleransı ve virülans rolü. J. Bakteriyol. 186, 3355�. doi: 10.1128/JB.186.11.3355-3362.204

Cohen-Or, I., Shenhar, Y., Biran, D. ve Ron, E.Z. (2010). CspC, rpoS transkript seviyelerini düzenler ve hfq silmelerini tamamlar. Araş. Mikrobiyol. 161, 694�. doi: 10.1016/j.resmic.2010.06.009

Davies, B.W., K'x000F6hrer, C., Jacob, A.I., Simmons, L.A., Zhu, J., Aleman, L.M., et al. (2011). Rolü Escherichia koli rRNA işlemede yüksek oranda korunmuş bir protein olan YbeY. Mol. Mikrobiyol. 78, 506�. doi: 10.1111/j.1365-2958.2010.07351.x

Deana, A. ve Belasco, J.G. (2005). Translasyonda kayıp: ribozomların bakteriyel mRNA bozunması üzerindeki etkisi. Genler Dev. 19, 2526�. doi: 10.1101/gad.1348805

De Lay, N., Schu, D.J. ve Gottesman, S. (2013). Bakteriyel küçük RNA tabanlı negatif düzenleme: Hfq ve suç ortakları. J. Biol. Kimya 288, 7996�. doi: 10.1074/jbc.R112.441386

Desnoyers, G., Bouchard, M.P. ve Mass'x000E9, E. (2013). Prokaryotlarda küçük RNA'ya bağlı translasyon düzenlemesine ilişkin yeni görüşler. Trendler Genet. 29, 92�. doi: 10.1016/j.tig.2012.10.004

Desnoyers, G. ve Masse, E. (2012). RNA şaperonu Hfq'nin küçük RNA alımı yoluyla translasyon başlangıcının kanonik olmayan baskısı. 42, 726�. doi: 10.1101/gad.182493.111

Du, H. ve Babitzke, P. (1998). trp RNA bağlayıcı zayıflama protein aracılı uzun mesafeli RNA yeniden katlanması, trpE'nin translasyonunu düzenler basil subtilis. J. Biol. Kimya 273, 20494�. doi: 10.1074/jbc.273.32.20494

Du, H., Tarpey, R. ve Babitzke, P. (1997). trp RNA bağlayıcı zayıflama proteini, trpG ribozom bağlanma bölgesine bağlanarak TrpG sentezini düzenler. basil subtilis. J. Bakteriyol. 179, 2582�.

Dubey, A.K., Baker, C.S., Romeo, T. ve Babitzke, P. (2005). RNA dizisi ve ikincil yapı, yüksek afiniteli CsrA – RNA etkileşimine katılır. RNA 11, 1579�. doi: 10.1261/rna.2990205.3

Dubey, A.K., Baker, C.S., Suzuki, K., Jones, A.D., Pandit, P., Romeo, T., et al. (2003). CsrA, Escherichia koli karbon açlığı geni, cstA, ribozomun cstA transkriptine erişimini bloke ederek. J. Bakteriyol. 185, 4450�. doi: 10.1128/JB.185.15.4450-4460.2003

Edwards, A.N., Patterson-Fortin, L.M., Vakulskas, C.A., Mercante, J.W., Potrykus, K., Vinella, D., et al. (2011). Csr ve katı yanıt küresel düzenleyici sistemleri birbirine bağlayan devre. Mol. Mikrobiyol. 80, 1561�. doi: 10.1111/j.1365-2958.2011.07663.x

Even, S., Pellegrini, O., Zig, L., Labas, V., Vinh, J., Br'sx000E9chemmier-Baey, D.,et al. (2005). Ribonükleazlar J1 ve J2: iki yeni endoribonükleaz B. subtilis fonksiyonel homoloji ile E. koli RNaz E. Nükleik Asitler Araş. 33, 2141�. doi: 10.1093/nar/gki505

Feng, Y., Huang, H., Liao, J. ve Cohen, S.N. (2001). Escherichia koli degradozomların bileşenleri ile etkileşime giren veya polinükleotid fosforilaz ve RNaz E'nin aracılık ettiği RNA bozulmasını engelleyen poli(A) bağlayıcı proteinler. J. Biol. Kimya 276, 31651�. doi: 10.1074/jbc.M102855200

Ferooz, J., Lemaire, J. ve Letesson, J.-J. (2011). FlbT'nin flagellin üretimindeki rolü brusella melitensis. Mikrobiyoloji 157, 1253�. doi: 10.1099/mic.0.044867-0

Figueroa-Bossi, N., Schwartz, A., Guillemardet, B., D’Heygère, F., Bossi, L. ve Boudvillain, M. (2014). Bakteriyel küresel düzenleyici CsrA tarafından RNA yeniden modellemesi, Rho'ya bağlı transkripsiyon sonlandırmasını destekler Genler Dev. 28, 1239�. doi: 10.1101/gad.240192.114

Finn, R.D., Bateman, A., Clements, J., Coggill, P., Eberhardt, R.Y., Eddy, S.R., et al. (2014). Pfam: protein aileleri veritabanı. Nükleik Asitler Araş. 42, D222�. doi: 10.1093/nar/gkt1223

Folichon, M. (2003). Poli(A) bağlayıcı protein Hfq, RNA'yı RNaz E'den ve eksoribonükleolitik bozunmadan korur. Nükleik Asitler Araş. 31, 7302�. doi: 10.1093/nar/gkg915

Gaballa, A., Antelmann, H., Aguilar, C., Khakh, S.K., Song, K.-B., Smaldone, G.T.,et al. (2008). NS basil subtilis demir-tutucu yanıt, Fur tarafından düzenlenen küçük bir RNA ve üç küçük, temel protein tarafından sağlanır. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 105, 11927�. doi: 10.1073/pnas.0711752105

Geissmann, T.A. ve Touati, D. (2004). Hfq, yeni bir refakatçi rolü: haberci RNA'ya bağlanma, küçük RNA düzenleyicisine erişimi belirler. EMBO J. 23, 396�. doi: 10.1038/sj.emboj.7600058

Gollnick, P., Babitzke, P., Antson, A. ve Yanofsky, C. (2005). triptofan biyosentezinin düzenlenmesindeki karmaşıklık basil subtilis. Annu. Rev. Genet. 39, 47�. doi: 10.1146/annurev.genet.39.073003.093745

G'x000F6pel, Y., Papenfort, K., Reichenbach, B., Vogel, J. ve G'x000F6rke, B. (2013). Düzenleyici küçük bir RNA'nın RNase E için bir adaptör protein tarafından hedeflenen bozunması ve bir anti-adaptör RNA tarafından karşı reaksiyon. Genler Dev. 27, 552�. doi: 10.1101/gad.210112.112

Hajnsdorf, E. ve Boni, I.V. (2012). RNA bağlayıcı proteinler S1 ve Hfq'nin çoklu aktiviteleri. biyokimya 94, 1544�. doi: 10.1016/j.biochi.2012.02.010

Hajnsdorf, E. ve R'x000E9gnier, P. (2000). Ana bilgisayar faktörü Hfq Escherichia koli poli(A) polimeraz I tarafından poli(A) kuyruklarının uzamasını uyarır. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 97, 1501�. doi: 10.1073/pnas.040549897

Hämmerle, H., Amman, F., Veຎrek, B., Stülke, J., Hofacker, I. ve Bläsi, U. (2014). Hfq'nin Etkisi basil subtilis transkriptome. PLoS BİR 9:e98661. doi: 10.1371/journal.pone.0098661

Henderson, C.A., Vincent, H.A., Casamento, A., Stone, C.M., Phillips, J.O., Cary, P.D.,et al. (2013). Hfq bağlamanın yapısını değiştirir Escherichia koli rpoS'nin riboregülasyonunda yer alan küçük kodlayıcı olmayan RNA'lar OxyS ve RprA. RNA 19, 1089�. doi: 10.1261/rna.034595.112

Herschlag, D. (1995). RNA şaperonları ve RNA katlama problemi. J. Biol. Kimya 270, 20871�. doi: 10.1074/jbc.270.36.20871

Hopkins, J.F., Panja, S. ve Woodson, S.A. (2011). RNA tavlaması sırasında Hfq'nin üçlü komplekslerden hızlı bağlanması ve salınması. Nükleik Asitler Araş. 39, 5193�. doi: 10.1093/nar/gkr062

Huttenhofer, A. ve Fnolier, H. (1994). Kimyasal problarla ayak izi mRNA- ribozom kompleksleri. EMBO J. 13, 3892�.

Ikeda, Y., Yağı, M., Morita, T. ve Aiba, H. (2011). RNase E'nin RhlB tanıma bölgesindeki Hfq bağlanması, sRNA'ların aracılık ettiği hedef mRNA'ların hızlı bozunması için çok önemlidir. Escherichia koli. Mol. Mikrobiyol. 79, 419�. doi: 10.1111/j.1365-2958.2010.07454.x

Irie, Y., Starkey, M., Edwards, A.N., Wozniak, D.J., Romeo, T. ve Parsek, M.R. (2010). Pseudomonas aeruginosa biyofilm matris polisakarit Psl, transkripsiyonel olarak RpoS tarafından ve transkripsiyon sonrası olarak RsmA tarafından düzenlenir. Mol. Mikrobiyol. 78, 158�. doi: 10.1111/j.1365-2958.2010.07320.x

Jacob, A.I., K'x000F6hrer, C., Davies, B.W., Rajbhandary, U.L. ve Walker, G.C. (2014). Korunan bakteriyel RNaz YbeY, 70S ribozom kalite kontrolünde ve 16S rRNA olgunlaşmasında kilit rol oynar. Mol. Hücre 49, 427�. doi: 10.1016/j.molcel.2012.11.025

Jerome, L.J., van Biesen, T. ve Frost, L.S. (1999). FinP antisens RNA'nın F benzeri plazmitlerden bozulması: RNA bağlayıcı protein FinO, FinP'yi ribonükleaz E'den korur. J. Mol. Biol. 285, 1457�. doi: 10.1006/jmbi.1998.2404

Jonas, K., Edwards, A.N., Simm, R., Romeo, T., R'x000F6mling, U. ve Melefors, O. (2008). RNA bağlayıcı protein CsrA, GGDEF proteinlerinin ekspresyonunu doğrudan düzenleyerek siklik di-GMP metabolizmasını kontrol eder. Mol. Mikrobiyol. 70, 236�. doi: 10.1111/j.1365-2958.2008.06411.x

Jørgensen, M.G., Thomason, M.K., Havelund, J., Valentin-Hansen, P. ve Storz, G. (2013). Biyofilm oluşumunu kontrol etmede McaS küçük RNA'nın ikili işlevi. Genler Dev. 27, 1132�. doi: 10.1101/gad.214734.113

Jutras, B.L., Chenail, A.M., Carroll, D.W., Miller, M.C., Zhu, H., Bowman A., et al. (2013a). Bpur, Lyme hastalığı spiroketinin PUR alan proteini: bir transkripsiyonel modülatör olarak tanımlama ve nükleik asit etkileşimlerinin karakterizasyonu. J. Biol. Kimya 288, 26220�. doi: 10.1074/jbc.M113.491357

Jutras, B.L., Jones, G.S., Verma, A., Brown, N.A., Antonicello, A.D., Chenail, A.M.,et al. (2013b). Lyme hastalığı bakterisinin BpuR DNA/RNA bağlayıcı proteini tarafından transkripsiyon sonrası kendi kendini düzenleme. J. Bakteriyol. 195, 4915�. doi: 10.1128/JB.00819-13

Kaberdin, V.R., Singh, D. ve Lin-Chao, S. (2011). Bakterilerde mRNA'yı bozan makinelerin bileşimi ve korunması. J. Biomed. bilim. 18, 23. doi: 10.1186/1423-0127-18-23

Kawamoto, H., Koide, Y., Morita, T. ve Aiba, H. (2006). Bakteriyel küçük bir RNA tarafından RNA susturulması ve Hfq ile dupleks oluşumunun hızlandırılması için baz eşleştirme gereksinimi. Mol. Mikrobiyol. 61, 1013�. doi: 10.1111/j.1365-2958.2006.05288.x

Kime, L., Jourdan, S.S., Stead, J.A., Hidalgo-Sastre, A. ve McDowall, K.J. (2010). 5'li monofosfat stimülasyonunun yokluğunda RNase E tarafından RNA'nın hızlı bölünmesi. Mol. Mikrobiyol. 76, 590�. doi: 10.1111/j.1365-2958.2009.06935.x

Koleva, R.I., Austin, C.A., Kowaleski, J.M., Neems, D.S., Wang, L., Vary, C.P.H.,et al. (2006). Ribozomal protein S1'in DsrA ve rpoS mRNA ile etkileşimleri. Biyokimya. Biyofiz. Araş. Komün. 348, 662�. doi: 10.1016/j.bbrc.2006.07.102

Komarova, A.V., Tchufistova, L.S., Dreyfus, M. ve Boni, I.V. (2005). 5'in çevrilmemiş liderleri içindeki AU-Zengin diziler, çeviriyi geliştirir ve mRNA'yı stabilize eder. Escherichia koli. J. Bakteriyol. 187, 1344�. doi: 10.1128/JB.187.4.1344

Kopaskie, K.S., Ligtenberg, K.G. ve Schneewind, O. (2013). Çeviri düzenlemesi Yersinia enterocolitica bir tip III salgılama substratını kodlayan mRNA. J. Biol. Kimya 288, 35478�. doi: 10.1074/jbc.M113.504811

Kovach, A.R., Hoff, K.E., Canty, J.T., Orans, J. ve Brennan, R.G. (2014). Gram-pozitif patojenden Hfq ile U-zengin RNA'nın tanınması Listeria monocytogenes. RNA 20, 1548�. doi: 10.1261/rna.044032.113

Kulkarni, P.R., Cui, X., Williams, J.W., Stevens, A.M. ve Kulkarni, R.V. (2006). Bakterilerde CsrA düzenleyici küçük RNA'ların tahmini ve bunların deneysel olarak doğrulanması vibrio fischeri. Nükleik Asitler Araş. 34, 3361�. doi: 10.1093/nar/gkl439

Lawhon, S.D., Frye, J.G., Suyemoto, M., Porwollik, S., McClelland, M. ve Altier, C. (2003). CsrA tarafından küresel düzenleme Salmonella typhimurium. Mol. Mikrobiyol. 48, 1633�. doi: 10.1046/j.1365-2958.2003.03535.x

Le Derout, J. (2003). Hfq, 3'ün sonundaki kısa oligo(A) kuyruklarının uzunluğunu ve sıklığını etkiler. Escherichia koli rpsO mRNA'ları. Nükleik Asitler Araş. 31, 4017�. doi: 10.1093/nar/gkg456

Le Derout, J., Boni, I.V., R'x000E9gnier, P. ve Hajnsdorf, E. (2010). Hfq, bozulmadan bağımsız olarak mRNA seviyelerini etkiler. BMC Mol. Biol. 11:17. doi: 10.1186/1471-2199-11-17.

Link, T.M., Valentin-Hansen, P. ve Brennan, R.G. (2009). Yapısı Escherichia koli Hfq, poliriboadenilat RNA'ya bağlanır. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 106, 19292�. doi: 10.1073/pnas.0908744106

Liu, J.M. ve Camilli, A. (2010). Bakteriyel küçük RNA'ların genişleyen dünyası. Kör. Görüş. Mikrobiyol. 13, 18�. doi: 10.1016/j.mib.2009.11.004

Liu, M.Y., Gui, G., Wei, B., Preston, J.F., Oakford, L., Yuksel, U., et al. (1997). RNA molekülü CsrB, global düzenleyici protein CsrA'ya bağlanır ve aktivitesini antagonize eder. Escherichia koli. J. Biol. Kimya 272, 17502�. doi: 10.1074/jbc.272.28.17502

Liu, M.Y., Yang, H. ve Romeo, T. (1995). pleiotropik ürün Escherichia koli csrA geni, mRNA stabilitesi üzerindeki etkiler yoluyla glikojen biyosentezini modüle eder. J. Bakteriyol. 177, 2663�.

Liu, Y., Wu, N., Dong, J., Gao, Y., Zhang, X., Mu, C., et al. (2010). Hfq, patojeniteyi kontrol eden küresel bir düzenleyicidir. stafilokok aureus. PLoS BİR 5:13069. doi: 10.1371/journal.pone.0013069

Lorenz, C., Gesell, T., Zimmermann, B., Schoeberl, U., Bilusic, I., Rajkowitsch, L.,et al. (2010). Hfq bağlayıcı RNA'lar için genomik SELEX, ağırlıklı olarak antisens transkriptlerinde genomik aptamerleri tanımlar. Nükleik Asitler Araş. 38, 3794�. doi: 10.1093/nar/gkq032

Lu, Y., Turner, R. ve Switzer, R. (1996). RNA ikincil yapılarının transkripsiyonel zayıflamadaki işlevi basil subtilis pir operonu. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 93, 14462�. doi: 10.1073/pnas.93.25.14462

Mackay, J.P., Font, J. ve Segal, D.J. (2011). Tasarımcı tek sarmallı RNA bağlayıcı proteinler için beklentiler. Nat. Yapı. Mol. Biol. 18, 256�. doi: 10.1038/nsmb.2005

Mackie, G.A. (1998). Ribonükleaz E, 5'e bağlı bir endonükleazdır. Doğa 395, 720�. doi: 10.1038/27246

Mackie, G.A. (2013). RNase E: bakteriyel RNA işleme ve bozunma arayüzünde. Nat. Rev. Mikrobiyol. 11, 45�. doi: 10.1038/nrmicro2930

Mahadevan, S. ve Wright, A. (1987). Transkripsiyon antiterminasyonunda yer alan bir bakteri geni: E. coli'nin bgl operonundaki rho-bağımsız bir sonlandırıcıda düzenleme. koli. Hücre 50, 485�. doi: 10.1016/0092-8674(87)90502-2

Mallory, A. ve Vaucheret, H. (2010). ARGONAUTE proteinlerinin formu, işlevi ve düzenlenmesi. Bitki hücresi 22, 3879�. doi: 10.1105/tpc.110.080671

Marden, J.N., Diaz, M.R., Walton, W.G., Gode, C.J., Betts, L., Urbanowski, M.L., et al. (2013). Alışılmadık bir CsrA ailesi üyesi, transkripsiyon sonrası yanıtları çoğaltmak için RsmA ile seri olarak çalışır. Pseudomonas aeruginosa. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 110, 15055�. doi: 10.1073/pnas.1307217110

Mass'x000E9, E., Escorcia, F.E. ve Gottesman, S. (2003). Küçük bir düzenleyici RNA ve onun mRNA hedeflerinin birleştiğinde Escherichia koli. gen geliştirme. 19, 2374�. doi: 10.1101/gad.1127103

Merino, E., Babitzke, P., Yanofsky, C., Merino, E., Babitzke, P. ve Yanofsky, C. (1995). trp RNA bağlayıcı zayıflama proteini (TRAP)-trp lider RNA etkileşimleri, basil subtilis trp operonu. J. Bakteriyol. 177, 6362�.

Mikulecky, P.J., Kaw, M.K., Brescia, C.C., Takach, J.C., Darren, D. ve Feig, A.L. (2004). Escherichia koli Hfq, DsrA, rpoS ve poly(A) RNA'lar için farklı etkileşim yüzeylerine sahiptir. Nat. Yapı. Mol. Biol. 11, 1206�. doi: 10.1038/nsmb858

Milojevic, T., Grishkovskaya, I., Sonnleitner, E., Djinovic-Carugo, K. ve Bl'x000E4si, U. (2013). NS Pseudomonas aeruginosa katabolit baskılama kontrol proteini Crc, RNA bağlama aktivitesinden yoksundur. PLoS BİR 8:e64609. doi: 10.1371/journal.pone.0064609

Mitobe, J., Yanagihara, I., Ohnishi, K., Yamamoto, S., Ohnishi, M., Ishihama, A.,et al. (2011). RodZ, transkripsiyon sonrası işlemeyi düzenler. Shigella sonnei Tip III salgı sistemi. EMBO Temsilcisi 12, 911𓤖. doi: 10.1038/embor.2011.132

Mohanty, B.K., Maples, V.F. ve Kushner, S.R. (2004). Sm benzeri protein Hfq, poliadenilasyona bağlı mRNA bozunmasını düzenler. Escherichia koli. Mol. Mikrobiyol. 54, 905𓤠. doi: 10.1111/j.1365-2958.2004.04337.x

Moll, I., Afonyushkin, T., Vytvytska, O. ve Kaberdin, V.R. (2003). mRNA ve küçük düzenleyici RNA'larda rastlantısal Hfq bağlama ve RNase E bölünme bölgeleri. RNA 11, 1308�. doi: 10.1261/rna.5850703

Møller, T., Franch, T., Højrup, P., Keene, D.R., Ba, H.P., Brennan, R.G.,et al. (2002). Hfq: RNA-RNA etkileşimine aracılık eden bakteriyel sm benzeri bir protein. Mol. Hücre 9, 23�. doi: 10.1016/S1097-2765(01)00436-1

Moreno, R., Hern'sx000E1ndez-Arranz, S., La Rosa, R., Yuste, L., Madhushani, A., Shingler, V.,et al. (2014). Crc ve Hfq proteinleri Pseudomonas putida katabolit baskılanmasında ve spesifik hedef motiflerle ribonükleik asit komplekslerinin oluşumunda işbirliği yapar. Çevre. Mikrobiyol. 17, 105�. doi: 10.1111/1462-2920.12499

Moreno, R., Marzi, S., Romby, P. ve Rojo, F. (2009). Crc küresel düzenleyici, eşlenmemiş A açısından zengin bir motife bağlanır. Pseudomonas putida alkS mRNA kodlama dizisi ve translasyonun başlamasını engeller. Nükleik Asitler Araş. 37, 7678�. doi: 10.1093/nar/gkp825

Morita, T., Maki, K. ve Aiba, H. (2005). RNase E-tabanlı ribonükleoprotein kompleksleri: bakteriyel kodlamayan RNA'ların aracılık ettiği mRNA dengesizleşmesinin mekanik temeli. gen geliştirme. 19, 2176�. doi: 10.1101/gad.1330405.1996

Morris, E.R., Hall, G., Li, C., Heeb, S., Kulkarni, R.V., Lovelock, L., et al. (2013). Bir RsmA/CsrA Ortologunda yapısal yeniden düzenleme pseudomonas aeruginosa bir dimerik RNA bağlayıcı protein, RsmN oluşturur. Yapı 21, 1659�. doi: 10.1016/j.str.2013.07.007

Mu'FB04er, A., Fischer, D. ve Hengge-Aronis, R. (1996). Faj Qbeta RNA replikasyonu için bir konak faktör olarak bilinen RNA bağlayıcı protein HF-I, rpoS translasyonu için esastır. Escherichia koli. Genler Dev. 10, 1143�. doi: 10.1101/gad.10.9.1143

Mukherjee, S., Yakhnin, H., Kysela, D., Sokoloski, J., Babitzke, P. ve Kearns, D.B. (2011). CsrA-FliW etkileşimi, flagellin homeostazını ve flagellar morfogenez üzerinde bir kontrol noktasını yönetir. basil subtilis. Mol. Mikrobiyol. 82, 447�. doi: 10.1111/j.1365-2958.2011.07822.x

Muto, Y., Oubridge, C. ve Nagai, K. (2000). RNA bağlayıcı proteinler: RNA bazlarını yakalama. Kör. Biol. 10, 19�. doi: 10.1016/S0960-9822(99)00250-X

Osborne, J., Djapgne, L., Tran, B.Q., Goo, Y.A. ve Oglesby-Sherrouse, A.G. (2014). Bakteriyel küçük RNA bağlayıcı proteinlerin in vivo tanımlanması için bir yöntem. Mikrobiyolojiaçık 3, 950�. doi: 10.1002/mbo3.220

Pandey, P, S., Winkler, J.A., Li, H., Camacho, D.M., Collins, J.J. ve Walker, G.C. (2014). Bakterilerde Hfq'ye bağımlı ve Hfq'dan bağımsız küçük RNA düzenlemesinde RNase YbeY'nin merkezi rolü. BMC Genomik 15:121. doi: 10.1186/1471-2164-15-121

Pandey, S.P., Minesinger, B.K., Kumar, J. ve Walker, G.C. (2011). Sinorhizobium meliloti'de yüksek oranda korunmuş, işlevi bilinmeyen bir protein, Hfq'ye benzer şekilde sRNA düzenlemesini etkiler. Nükleik Asitler Araş. 39, 4691�. doi: 10.1093/nar/gkr060

Patterson-Fortin, L.M., Vakulskas, C.A., Yakhnin, H., Babitzke, P. ve Romeo, T. (2013). Kofaktöre duyarlı bir mRNA lideri aracılığıyla çift transkripsiyon sonrası düzenleme. J. Mol. Biol. 425, 3662�. doi: 10.1016/j.jmb.2012.12.010

Perez-Rueda, E. ve Martinez-Nu༞z, M.A. (2012). Prokaryotlarda DNA bağlayıcı transkripsiyon faktörlerinin repertuarı: fonksiyonel ve evrimsel dersler. bilim prog. 95, 315�. doi: 10.3184/003685012X13420097673409

Phadtare, S., Inouye, M. ve Severinov, K. (2002). Nükleik asit eritme aktivitesi Escherichia koli CspE, transkripsiyon antiterminasyonu ve hücrelerin soğuğa alışması için kritiktir. J. Biol. Kimya 277, 7239�. doi: 10.1074/jbc.M111496200

Picard, F., Dressaire, C., Girbal, L. ve Cocaign-Bousquet, M. (2009).Prokaryotlarda transkripsiyon sonrası düzenlemelerin bütünleştirici biyoloji ile incelenmesi. C.R. Biol. 332, 958�. doi: 10.1016/j.crvi.2009.09.005

Rabhi, M., Esp'x000E9li, O., Schwartz, A., Cayrol, B., Rahmouni, A.R., Arluison, V.,et al. (2011). Sm-benzeri RNA şaperonu Hfq, Rho-bağımlı terminatörlerde transkripsiyon antiterminasyonuna aracılık eder. EMBO J. 30, 2805�. doi: 10.1038/emboj.2011.192

Ramesh, A., DebRoy, S., Goodson, J.R., Fox, K.A., Faz, H., Garsin, D.A.,et al. (2012). Gen ekspresyonunun ANTAR düzenleyicileri tarafından RNA tanıma mekanizması. PLoS Genet. 8:e1002666. doi: 10.1371/journal.pgen.1002666

Rasmussen, A.A., Eriksen, M., Gilany, K., Udesen, C., Franch, T., Petersen, C.,et al. (2005). OmpA mRNA stabilitesinin düzenlenmesi: büyüme fazına bağlı kontrolde küçük bir düzenleyici RNA'nın rolü. Mol. Mikrobiyol. 58, 1421�. doi: 10.1111/j.1365-2958.2005.04911.x

R'x000E9gnier, P. ve Hajnsdorf, E. (2013). Rho'dan bağımsız sonlandırmadan kaynaklanan RNA'ların 3'üncü ucundaki Hfq, poli(A) polimeraz I ve eksoribonükleazların etkileşimi: geçici bir model. RNA Biol. 10, 602�. doi: 10.4161/rna.23664

Reimmann, C., Valverde, C., Kay, E. ve Haas, D. (2005). Biyokontrol suşunda RsmA ile birlikte hareket eden RNA bağlayıcı protein RsmE tarafından GacS / GacA kontrollü genlerin transkripsiyon sonrası baskısı Pseudomonas floresan CHA0. J. Bakteriyol. 187, 276�. doi: 10.1128/JB.187.1.276

Rieder, R., Reinhardt, R., Sharma, C. ve Vogel, J. (2012). RNA-protein etkileşimlerini tanımlamak için deneysel araçlar Helikobakter pilori. RNA Biol. 9, 520�. doi: 10.4161/rna.20331

Romeo, T., Vakulskas, C.A. ve Babitzke, P. (2013). Küresel ölçekte transkripsiyon sonrası düzenleme: Csr/Rsm sistemlerinin biçimi ve işlevi. Çevre. Mikrobiyol. 15, 313�. doi: 10.1111/j.1462-2920.2012.02794.x

Rutberg, B. (1997). Katabolik operonların transkripsiyonunun MicroReview antiterminasyonu. Mol. Mikrobiyol. 23, 413�. doi: 10.1046/j.1365-2958.1997.d01-1867.x

Said, N., Rieder, R., Hurwitz, R., Deckert, J., Urlaub, H. ve Vogel, J. (2009). Aptamer etiketli küçük RNA düzenleyicilerinin in vivo ekspresyonu ve saflaştırılması. Nükleik Asitler Res. 37, e133. doi: 10.1093/nar/gkp719

Salvail, H., Caron, M.-P., B'x000E9langer, J. ve Mass'x000E9, E. (2013). RNA şaperonu Hfq ve bir sRNA arasındaki antagonistik işlevler, antibiyotik kolisin duyarlılığını düzenler. EMBO J. 32, 2764�. doi: 10.1038/emboj.2013.205

Santangelo, T.J. ve Artsimovitch, I. (2011). Sonlandırma ve sonlandırma: RNA polimeraz bir dur işareti çalıştırır. Nat. Rev. Mikrobiyol. 9, 319�. doi: 10.1038/nrmicro2560

Saramago, M., B'x000E1rria, C., Dos Santos, R.F., Silva, I.J., Pobre, V., Domingues, S.,et al. (2014). Küçük RNA'ların düzenlenmesinde RNazların rolü. Kör. Görüş. Mikrobiyol. 18, 105�. doi: 10.1016/j.mib.2014.02.009

Sarsero, J.P., Merino, E. ve Yanofsky, C. (2000). A basil subtilis önceden bilinmeyen işlevli gen, yhaG, triptofan ile aktive olan TRAP tarafından translasyonel olarak düzenlenir ve triptofan taşınımına dahil olduğu görülmektedir. J. Bakteriyol. 182, 2329�. doi: 10.1128/JB.182.8.2329-2331.2000

Sauer, E. (2013). Bakteriyel LSm proteini Hfq'nin yapısı ve RNA bağlama özellikleri. RNA Biol. 10, 610�. doi: 10.4161/rna.24201

Sauer, E., Schmidt, S. ve Weichenrieder, O. (2012). Hfq heksamerlerin yan yüzeyine bağlanan küçük RNA ve mRNA hedef tanıma üzerine yapısal yeniden düzenlemeler. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 109, 9396�. doi: 10.1073/pnas.1202521109

Schiano, C.A. ve Lathem, W.W. (2012). gen ekspresyonunun transkripsiyon sonrası düzenlenmesi Yersinia Türler. Ön. Hücre. Bulaştır. Mikrobiyol. 2:129. doi: 10.3389/fcimb.2012.00129

Schnetz, K. ve Rak, B. (1988). bgl operonunun düzenlenmesi Escherichia koli transkripsiyonel antiterminasyon ile. EBO J. 7, 3271�.

Schumacher, M.A., Pearson, R.F., M'x000F8ller, T., Valentin-Hansen, P. ve Brennan, R.G. (2002). Pleiotropik translasyonel düzenleyici Hfq ve bir Hfq-RNA kompleksinin yapıları: bir bakteriyel Sm benzeri protein. EMBO J. 21, 3546�. doi: 10.1093/emboj/cdf322

Shahbabian, K., Jamalli, A., Zig, L. ve Putzer, H. (2009). Yeni bir endoribonükleaz olan RNase Y, riboswitch dönüşümünü başlatır. basil subtilis. EMBO J. 28, 3523�. doi: 10.1038/emboj.2009.283

Sheidy, D.T. ve Zielke, R.A. (2013). Rolünün analizi ve genişletilmesi Escherichia koli protein ProQ. PLoS BİR 8:e79656. doi: 10.1371/journal.pone.0079656

Shine, J. ve Dalgarno, L. (1974). 3’-terminal dizisi Escherichia koli 16S ribozomal RNA: anlamsız üçlülere ve ribozom bağlanma bölgelerine tamamlayıcılık. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 71, 1342�. doi: 10.1073/pnas.71.4.1342

Smaldone, G.T., Antelmann, H., Gaballa, A. ve Helmann, J.D. (2012). FsrA sRNA ve FbpB proteini, demire bağımlı indüksiyona aracılık eder. basil subtilis lutABC demir-kükürt içeren oksidazlar. J. Bakteriyol. 194, 2586�. doi: 10.1128/JB.05567-11

Snyder, D., Lary, J., Chen, Y., Gollnick, P. ve Cole, J.L. (2004). trp RNA bağlayıcı zayıflama proteininin (TRAP) anti-TRAP ile etkileşimi. J. Mol. Biol. 338, 669�. doi: 10.1016/j.jmb.2004.03.030

Sobrero, P. ve Valverde, C. (2012). Bakteriyel protein Hfq: sadece bir RNA bağlayıcı faktörden çok daha fazlası. Krit. Rev. Mikrobiyol. 38, 276�. doi: 10.3109/1040841X.2012.664540

Sonnleitner, E., Abdou, L. ve Haas, D. (2009). Küçük RNA, karbon katabolit baskısının küresel düzenleyicisi olarak Pseudomonas aeruginosa. Proc. Natl. Acad. bilim AMERİKA BİRLEŞİK DEVLETLERİ. 106, 21866�. doi: 10.1073/pnas.pnas.0910308106

Sonnleitner, E. ve Bl'x000E4si, U. (2014). Hfq'nin RNA CrcZ tarafından düzenlenmesi Pseudomonas aeruginosa karbon katabolit baskısı. PLoS Genet. 10:e1004440. doi: 10.1371/journal.pgen.1004440

Soper, T.J., Doxzen, K. ve Woodson, S.A. (2011). Hfq tarafından sRNA alımında mRNA bağlanması ve yeniden yapılandırılması için ana rol. RNA 17, 1544�. doi: 10.1261/rna.2767211

Sorger-Domenigg, T., Sonnleitner, E., Kaberdin, V.R. ve Bl'x000E4si, U. (2007). Farklı ve örtüşen bağlanma bölgeleri Pseudomonas aeruginosa Kodlamayan RNA RsmY üzerindeki Hfq ve RsmA proteinleri. Biyokimya. Biyofiz. Araş. Komün. 352, 769�. doi: 10.1016/j.bbrc.2006.11.084

Sterzenbach, T., Nguyen, K.T., Nuccio, S.-P., Winter, M.G., Vakulskas, C.A., Clegg, S.,et al. (2013). Yeni bir CsrA titrasyon mekanizması, fimbrial gen ekspresyonunu düzenler. Salmonella typhimurium. EMBO J. 32, 2872�. doi: 10.1038/emboj.2013.206

Storz, G., Vogel, J. ve Wassarman, K.M. (2011). Bakterilerde küçük RNA'lar tarafından düzenleme: genişleyen sınırlar. Mol. Hücre 43, 880�. doi: 10.1016/j.molcel.2011.08.022

St'x000FClke, J. (2002). RNA yapılarını modüle eden RNA bağlayıcı proteinler tarafından bakterilerde transkripsiyon sonlandırmasının kontrolü. Kemer Mikrobiyol. 177, 433�. doi: 10.1007/s00103-002-0407-5

Subramanian, A.R. (1983). Ribozomal protein S1'in yapısı ve işlevleri. prog. Nükleik Asit Arş. Mol. Biol. 28, 101�. doi: 10.1016/S0079-6603(08)60085-9

Suzuki, K., Babitzke, P., Kushner, S.R. ve Romeo, T. (2006). RNase E tarafından bozunma için küresel düzenleyici RNA'lar CsrB ve CsrC'yi hedefleyen yeni bir düzenleyici proteinin (CsrD) tanımlanması. gen geliştirme. 20, 2605�. doi: 10.1101/gad.1461606

Tortosa, P., Lindner, C., Saier, M.H., Reizer, J. ve Le Coq, D. (1997). SacY'nin Çoklu Fosforilasyonu, bir basil subtilis Fosfotransferaz sistemi tarafından negatif olarak kontrol edilen transkripsiyonel antiterminatör. J. Biol. Kimya 272, 17230�. doi: 10.1074/jbc.272.27.17230

Tsai, B.P., Wang, X., Huang, L. ve Waterman, M.L. (2011). Yeni bir entegre proteomik yaklaşım kullanarak in vivo olarak birleştirilmiş RNA-protein komplekslerinin kantitatif profili Mol. Hücre Proteomikleri 10, M110.007385. doi:10.1074/mcp.M110.007385

Tsui, H.C., Leung, H.C. ve Winkler, M.E. (1994). Bir hfq yerleştirme mutasyonunun neden olduğu geniş pleiotropik fenotiplerin karakterizasyonu Escherichia koli #x0201312. Mol. Mikrobiyol. 13, 35�. doi: 10.1111/j.1365-2958.1994.tb00400.x

Vecerek, B., Moll, I. ve Bl'x000E4si, U. (2005). Çevirisel otokontrol Escherichia koli hfq RNA şaperon geni. RNA 11, 976�. doi: 10.1261/rna.2360205

Vercruysse, M., K'x000F6hrer, C., Davies, B.W., Arnold, M.F.F., Mekalanos, J.J., RajBhandary, U.L.,et al. (2014). Yüksek oranda korunmuş bakteriyel RNase YbeY, virülans, stres regülasyonu ve RNA işlemede kritik bir rol oynayan vibrio cholerae'da esastır. PLoS Patog'u. 10:e1004175. doi: 10.1371/journal.ppat.1004175

Vogel, J. ve Luisi, B.F. (2011). Hfq ve RNA takımyıldızı. Nat. Rev. Mikrobiyol. 9, 578�. doi: 10.1038/nrmicro2615

Vytvytska, O., Moll, I., Kaberdin, V.R., Von Gabain, A. ve Bl'sx000E4si, U. (2000). Hfq (HF1) bağlanması, ribozom bağlanmasına müdahale ederek ompA mRNA bozulmasını uyarır. gen geliştirme. 14, 1109�. doi: 10.1101/gad.14.9.1109

Wang, M.-C., Chien, H.-F., Tsai, Y.-L., Liu, M.-C. ve Liaw, S.-J. (2014). RNA şaperonu Hfq, üropatojenikte stres toleransı ve virülans ile ilgilidir. Proteus mirabilis. PLoS BİR 9:e85626. doi: 10.1371/journal.pone.0085626

Wang, X., Dubey, A.K., Suzuki, K., Baker, C.S., Babitzke, P. ve Romeo, T. (2005). CsrA, bir biyofilm polisakarit yapıştırıcısının sentezinden sorumlu olan pgaABCD'yi transkripsiyon sonrası olarak baskılar. Escherichia koli. Mol. Mikrobiyol. 56, 1648�. doi: 10.1111/j.1365-2958.2005.04648.x

Weilbacher, T., Suzuki, K., Dubey, A.K., Wang, X., Gudapaty, S., Morozov, I.,et al. (2003). karbon depolama düzenleyici sisteminin yeni bir sRNA bileşenidir. Escherichia koli. Mol. Mikrobiyol. 48, 657�. doi: 10.1046/j.1365-2958.2003.03459.x

Windbichler, N., von Pelchrzim, F., Mayer, O., Csaszar, E. ve Schroeder, R. (2008). E. coli'den küçük RNA bağlayıcı proteinlerin izolasyonu. koli: RNA'ların RNA polimeraz ile sık etkileşimi için kanıt. RNA Biol. 5, 30�. doi: 10.4161/rna.5.1.5694

Yakhnin, A.V, Baker, C.S., Vakulskas, C.A., Yakhnin, H., Berezin, I., Romeo, T.,et al. (2014). CsrA, flhDC mRNA'yı RNase E aracılı bölünmeden koruyarak flhDC ifadesini aktive eder. Mol. Hücre 87, 851�. doi: 10.1111/mmi.12136.CsrA

Yakhnin, H., Baker, C.S., Berezin, I., Evangelista, M.A., Rassin, A., Romeo, T.,et al. (2011a). CsrA, N-açilhomoserin-L-lakton reseptörünü kodlayan sdiA'nın çevirisini bastırır. Escherichia koli, yalnızca sdiA mRNA'nın kodlama bölgesi içinde bağlanarak. J. Bakteriyol. 193, 6162�. doi: 10.1128/JB.05975-11

Yakhnin, H., Yakhnin, A.V., Baker, C.S., Sineva, E., Berezin, I., Romeo, T.,et al. (2011b). Küresel düzenleyici gen csrA'nın karmaşık regülasyonu: CsrA aracılı translasyonel baskı, Esigma70 veEsigmaS tarafından beş promotörden transkripsiyon ve CsrA tarafından dolaylı transkripsiyonel aktivasyon. Mol. Mikrobiyol. 81, 689�. doi: 10.1111/j.1365-2958.2011.07723.x

Yakhnin, H., Zhang, H., Yakhnin, A.V. ve Babitzke, P. (2004). trp RNA bağlayıcı zayıflama proteini basil subtilis ribozom bağlanmasını bloke ederek triptofan taşıma geni trpP'nin (yhaG) translasyonunu düzenler. J. Bakteriyol. 186, 278�. doi: 10.1128/JB.186.2.278

Yang, M., de Saizieu, A., van Loon, A.P. ve Gollnick, P. (1995). trpG'un çevirisi basil subtilis trp RNA bağlayıcı zayıflama proteini (TRAP) tarafından düzenlenir. J. Bakteriyol. 177, 4272�.

Zha, D., Xu, L., Zhang, H. ve Yan, Y. (2014). İki bileşenli GacS-GacA Sistemi, RsmE tarafından lipA çevirisini etkinleştirir, ancak RsmA'yı etkinleştirmez. Pseudomonas proteinler Pf-5. Uygulama Çevre. Mikrobiyol. 80, 6627�. doi: 10.1128/AEM.02184-14

Zhang, A., Wassarman, K.M., Ortega, J., Steven, A.C. ve Storz, G. (2002). Sm benzeri Hfq proteini, hedef mRNA'lar ile OxyS RNA etkileşimini arttırır. Mol. Hücre 9, 11�. doi: 10.1016/S1097-2765(01)00437-3

Anahtar Kelimeler : transkripsiyon sonrası düzenleme, RNA bağlayıcı proteinler, bakteriler, çalışma mekanizmaları, biyoteknolojik uygulamalar, translasyonun düzenlenmesi, stabilite düzenlemesi

Alıntı: Van Assche E, Van Puyvelde S, Vanderleyden J ve Steenackers HP (2015) Bakterilerde transkripsiyon sonrası düzenlemede yer alan RNA bağlayıcı proteinler. Ön. Mikrobiyol. 6:141. doi: 10.3389/fmicb.2015.00141

Geliş: 24 Aralık 2014 Bildiri askıda yayınlandı: 24 Ocak 2015
Kabul tarihi: 06 Şubat 2015 Online yayın tarihi: 03 Mart 2015.

Martin G. Klotz, Kuzey Karolina Üniversitesi, Charlotte, ABD

Brian Stevenson, Kentucky Üniversitesi, ABD
Paul Babitzke, Penn State Üniversitesi, ABD

Telif hakkı © 2015 Van Assche, Van Puyvelde, Vanderleyden ve Steenackers. Bu, Creative Commons Atıf Lisansı (CC BY) koşulları altında dağıtılan açık erişimli bir makaledir. Orijinal yazar(lar)a veya lisans verene atıfta bulunulması ve kabul edilen akademik uygulamaya uygun olarak bu dergideki orijinal yayına atıfta bulunulması koşuluyla, diğer forumlarda kullanım, dağıtım veya çoğaltmaya izin verilir. Bu şartlara uymayan hiçbir kullanım, dağıtım veya çoğaltmaya izin verilmez.


Videoyu izle: Yalvaç Fen Lisesi Protein sentezi şarkısı (Ocak 2022).